No abstract

We tested the effects of irradiances of 920 and 1200 mW m−2 (weighted irradiance) on the conidia and germinants of the entomopathogenic Hyphomycete Metarhizium anisopliae. The conidia were exposed to the two irradiances for 1, 2, 4, 6, 7 or 8 h. Increased exposure decreased relative percent culturability. The inactivation provoked by the irradiance of 1200 mW m−2 was higher than for the 920 mW m−2, with a reduction in the 50% lethal time (LT50) from 6 h 40 min to 4 h 26 min. Reciprocity was not observed when conidia in water suspension and germinants in different stages of the germinative process were exposed to a 17.3 kJ m−2 total dose at both irradiance levels. Although nonreciprocity was observed in all situations, its magnitude varied as a function of metabolic state and/or cell‐cycle phase in which the conidia were at the exposure time. The least difference between the effects of the two irradiance levels was observed when nongerminating conidia in suspension were exposed, and the greatest was observed when conidia were exposed during an advanced germination phase. Doses of 6.6 and 17.3 kJ m−2 supplied through the two irradiance levels delayed the germination of the surviving conidia. At both doses, delay was greater during exposure to the higher irradiance. Nonreciprocity was higher for the 17.3 kJ m−2 dose. Nonreciprocity magnitude, in addition to depending on the conidial physiological state, also depended on dose. The results demonstrate the importance of evaluating the impact of the increase in irradiance during the different stages of the fungal life cycle, especially during the stages which are more sensitive to UV, and not simply in dormant conidia.

In order to construct specific primers for the detection and identification of the entomopathogenic fungus Metarhizium within infected sugarcane borer (Diatraea saccharalis) larvae we analyzed the ITS1 -5.8S-ITS2 rDNA regions of strains and varieties of M. anisopliae, M. album and M. flavoviride. The PCR amplification of these regions yielded a unique fragment of approximately 540 bp for M. anisopliae variety anisopliae strains E 9 , B/Vi and C (isolated in Brazil), 600 pb for M. a. anisopliae strain 14 (isolated in Australia), 650 bp for the M. album and 600 bp for M. flavoviride strains. The PCR products were digested with different restriction endonucleases (Afa I, Alu I, Dde I, Hae III, Hpa II and Sau 3A) and the PCR-RFLP profiles showed clear differences between the species. Sequencing of the ITS-5.8S rDNA regions allowed us to design one specific primer (ITSMet: 5' TCTGAATTTTTTATAAGTAT 3') for the Brazilian M. a. anisopliae strains (E 9 , B/Vi and C) and another specific primer (ITSMet14: 5' GAAACCGGGAC TAGGCGC 3') for the Australian strain (strain 14). Amplification was not observed with M. album, M flavoviride and Beauveria bassiana strains. DNA extracted from larvae infected with the Brazilian or Australian strains were tested using the specific primers designed by us to identify the fungal strains with which the larva had been infected. The correct fungal strain was successfully detected within 48 h of the insect having been infected, showing that this molecular technique allows rapid and secure detection and identification of M. anisopliae.

Metarhizium anisopliae isolates have a wide insect host range, but an impediment to their commercial use as a biocontrol agent of above-ground insects is the high susceptibility of spores to the near-UV present in solar irradiation. To understand stress responses in M. anisopliae, we initiated studies of enzymes that protect against oxidative stress in two strains selected because their spores differed in sensitivity to UV-B. Spores of the more near-UV resistant strain in M. anisopliae 324 displayed different isozyme profiles for catalase-peroxidase, glutathione reductase, and superoxide dismutase when compared with the less resistant strain 2575. A transient loss in activity of catalase-peroxidase and glutathione reductase was observed during germination of the spores, whereas the intensity of isozymes displaying superoxide dismutase did not change as the mycelium developed. Isozyme composition for catalase-peroxidases and glutathione reductase in germlings changed with growth phase. UV-B exposure from lamps reduced the activity of isozymes displaying catalase-peroxidase and glutathione reductase activities in 2575 more than in 324. The major effect of solar UV-A plus UV-B also was a reduction in catalase-peroxidases isozyme level, a finding confirmed by measurement of catalase specific activity. Impaired growth of M. anisopliae after near-UV exposure may be related to reduced abilities to handle oxidative stress.

No abstract