Background and Aim: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs. Materials and Methods: Beef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5'CATGGGGACGAGGACTATACTATG '3 and reverse primer: 5'GTAGTCCCAATGTAAGGGATAGCTG'3. Results: Our study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs. Conclusion: The PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia.

Companies which engaged in production activities such as Ramadhan Bakery would want optimal profit in their every production. The aim of this study was to find optimal profit and optimal combination of bread production (original chocolate bread, extra chocolate bread, rounding chocolate bread and mattress chocolate bread) that was produced by Ramadhan Bakery by applying Branch and Bound Algorithm method. Branch and Bound Algorithm is one method to solve Integer Programming’s problems other than Cutting Plane method. Compared with Cutting Plane method, Branch and Bound Algorithm method is more effective in determining the optimal value. As the result of this study showed that to get optimal profit, Ramadhan Bakery should produce 360 pcs of original chocolate bread, 300 pcs of extra chocolate bread, 306 pcs of rounding chocolate bread and 129 pcs of mattress chocolate bread with optimal profit amounts Rp. 1.195.624,00.. The profit will increase amounts 25,2 % than before.