DNA fingerprinting of Mycobacterium tuberculosis has been shown to be a powerful epidemiologic tool. We propose a standardized technique which exploits variability in both the number and genomic position of IS6110 to generate strain-specific patterns. General use of this technique will permit comparison of results between different laboratories. Such comparisons will facilitate investigations into the international transmission of tuberculosis and may identify specific strains with unique properties such as high infectivity, virulence, or drug resistance.

A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR). The sequences of the primers (5' to 3') were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG, and a temperature of 68 degrees C was used for annealing the primers in the reaction. Amplification produced a 123-base-pair fragment with an internal SalI site. The specific PCR product was obtained with input DNA from 11 different strains of M. tuberculosis and Mycobacterium bovis and one strain of Mycobacterium simiae. No product was detected with DNA from 28 strains of the Mycobacterium avium complex, Mycobacterium scrofulaceum, Mycobacterium kansasii, Mycobacterium fortuitum, Mycobacterium chelonei, and Mycobacterium gordonae. The PCR product was detected by gel electrophoresis after 30 cycles using 1 fg of input DNA. Amplification of this sequence may provide the basis for an assay to detect M. tuberculosis directly in clinical material.

Generalist and specialist species differ in the breadth of their ecological niche. Little is known about the niche width of obligate human pathogens. Here we analyzed a global collection of Mycobacterium tuberculosis Lineage 4 clinical isolates, the most geographically widespread cause of human tuberculosis. We show that Lineage 4 comprises globally distributed and geographically restricted sublineages, suggesting a distinction between generalists and specialists. Population genomic analyses showed that while the majority of human T cell epitopes were conserved in all sublineages, the proportion of variable epitopes was higher in generalists. Our data further support a European origin for the most common generalist sublineage. Hence, the global success of Lineage 4 reflects distinct strategies adopted by different sublineages and the influence of human migration.

We analyzed a global collection of Mycobacterium tuberculosis strains using 212 single nucleotide polymorphism (SNP) markers. SNP nucleotide diversity was high (average across all SNPs, 0.19), and 96% of the SNP locus pairs were in complete linkage disequilibrium. Cluster analyses identified six deeply branching, phylogenetically distinct SNP cluster groups (SCGs) and five subgroups. The SCGs were strongly associated with the geographical origin of the M. tuberculosis samples and the birthplace of the human hosts. The most ancestral cluster (SCG-1) predominated in patients from the Indian subcontinent, while SCG-1 and another ancestral cluster (SCG-2) predominated in patients from East Asia, suggesting that M. tuberculosis first arose in the Indian subcontinent and spread worldwide through East Asia. Restricted SCG diversity and the prevalence of less ancestral SCGs in indigenous populations in Uganda and Mexico suggested a more recent introduction of M. tuberculosis into these regions. The East African Indian and Beijing spoligotypes were concordant with SCG-1 and SCG-2, respectively; X and Central Asian spoligotypes were also associated with one SCG or subgroup combination. Other clades had less consistent associations with SCGs. Mycobacterial interspersed repetitive unit (MIRU) analysis provided less robust phylogenetic information, and only 6 of the 12 MIRU microsatellite loci were highly differentiated between SCGs as measured by G ST . Finally, an algorithm was devised to identify two minimal sets of either 45 or 6 SNPs that could be used in future investigations to enable global collaborations for studies on evolution, strain differentiation, and biological differences of M. tuberculosis.Compared to many bacterial species, Mycobacterium tuberculosis harbors relatively little genetic diversity (21, 34, 37); however, there is increasing evidence that the interstrain variation that exists is biologically significant. Clinical M. tuberculosis isolates have variable gene expression profiles (25) and have different numbers of genes deleted from their chromosome (32). In animal models, M. tuberculosis appears to engender a range of immune responses and variable degrees of virulence depending on the infecting strain (5,7,47,55). In human infections, molecular epidemiological studies have suggested that certain M. tuberculosis types, identified by DNA fingerprinting, can be especially prone to drug resistance acquisition (17, 59, 65) or to global dissemination (3, 9, 27, 40, 66,