A Jacob/Nsmf Gene Knockout Results in Hippocampal Dysplasia and Impaired BDNF Signaling in Dendritogenesis

Spilker, Christina; Nullmeier, Sven; Grochowska, Katarzyna M.; Schumacher, Anne; Butnaru, Ioana; Macharadze, Tamar; Gomes, Guilherme M.; Yuanxiang, PingAn; Bayraktar, Gonca; Rodenstein, Carolin; Geiseler, Carolin; Kolodziej, Angela; Lopez‐Rojas, Jeffrey; Montag, Dirk; Angenstein, Frank; Bär, Julia; D'Hanis, Wolfgang; Roskoden, Thomas; Mikhaylova, Marina; Budinger, Eike; Ohl, Frank W.; Stork, Oliver; Zenclussen, Ana Claudia; Karpova, Anna; Schwegler, Herbert; Kreutz, Michael R.

doi:10.1371/journal.pgen.1005907

Cited by 40 publications

(53 citation statements)

References 62 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…After washing in PBS, cells were blocked for 1 h at room temperature in blocking buffer (2% glycine, 2% BSA, 0.2% gelatine and 50 mM NH 4 Cl). The primary antibodies were applied rb anti‐pJacob‐Ser180 (1:500), rb anti‐Jacob (1:300), rb anti‐pCREB Ser133 (1:500, Cell Signalling, Cat. No.…”

Section: Methodsmentioning

confidence: 99%

Posttranslational modification impact on the mechanism by which amyloid‐β induces synaptic dysfunction

et al. 2017

Self Cite

View full text Add to dashboard Cite

Oligomeric amyloid-β (Aβ) 1-42 disrupts synaptic function at an early stage of Alzheimer's disease (AD). Multiple posttranslational modifications of Aβ have been identified, among which N-terminally truncated forms are the most abundant. It is not clear, however, whether modified species can induce synaptic dysfunction on their own and how altered biochemical properties can contribute to the synaptotoxic mechanisms. Here, we show that a prominent isoform, pyroglutamated Aβ3(pE)-42, induces synaptic dysfunction to a similar extent like Aβ1-42 but by clearly different mechanisms. In contrast to Aβ1-42, Aβ3(pE)-42 does not directly associate with synaptic membranes or the prion protein but is instead taken up by astrocytes and potently induces glial release of the proinflammatory cytokine TNFα. Moreover, Aβ3(pE)-42-induced synaptic dysfunction is not related to NMDAR signalling and Aβ3(pE)-42-induced impairment of synaptic plasticity cannot be rescued by D1-agonists. Collectively, the data point to a scenario where neuroinflammatory processes together with direct synaptotoxic effects are caused by posttranslational modification of soluble oligomeric Aβ and contribute synergistically to the onset of synaptic dysfunction in AD.

show abstract

Section: Methodsmentioning

confidence: 99%

Posttranslational modification impact on the mechanism by which amyloid‐β induces synaptic dysfunction

et al. 2017

Self Cite

View full text Add to dashboard Cite

show abstract

“…GGCATGACAGATACCAAAGC (48). Primers for confirming the deletion of Jacob/Nsmf gene were described previously (83).…”

Section: Genotyping Of Jacob/tba21 Micementioning

confidence: 99%

Preventing Jacob-induced transcriptional inactivation of CREB protects synapses from β-amyloid in Alzheimer’s Disease

Kaushik

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

Disruption of transcriptional activity of cAMP-responsive element-binding protein (CREB), a master regulator of cell survival and plasticity-related gene expression, is a hallmark of neurodegenerative diseases. CREB shut-off results in synaptic dysfunction and neuronal cell death and is elicited in Alzheimer's disease (AD) by amyloid-βinduced activation of extrasynaptic N-methyl-D-aspartate-receptors (NMDAR).Following long-distance transport from NMDAR to the nucleus the protein messenger Jacob docks a signalosome to CREB that encodes the synaptic or extrasynaptic origin of the NMDAR signal. In previous work we found that in response to cell survival/plasticity related synaptic NMDAR stimulation macromolecular transport of Jacob docks the MAP-kinase ERK to the CREB complex which results in sustained CREB phosphorylation. Here we show that in case of disease-related activation of extrasynaptic NMDAR by amyloid-β, Jacob associates with protein phosphatase-1γ (PP1γ) and induces dephosphorylation and transcriptional inactivation of CREB.Binding of the adaptor protein LIM domain only 4 (LMO4) to Jacob distinguishes extrasynaptic from synaptic NMDAR signaling and determines the affinity for the association with PP1γ. This mechanism contributes to transcriptional inactivation of CREB in response to extrasynaptic NMDAR signaling in the context of early synaptic dysfunction and cell loss in AD. Accordingly, Jacob protein knockdown attenuates CREB shut-off and cellular deterioration in response to amyloid-β signaling and Jacob gene knock out is neuroprotective in a transgenic mouse model of AD.

show abstract

“…Primary hippocampal mouse cultures from Myo6 sv/sv and Myo6 +/+ mice were prepared as described (Spilker et al, 2016). Briefly, hippocampi were dissected from male and female P0 Myo6 sv/sv and Myo6 +/+ mice and cells were dissociated after 10 min treatment with trypsin at 37 °C.…”

Section: Primary Neuronal Culture and Transfectionsmentioning

confidence: 99%

Characterization of neuronal synaptopodin reveals a myosin V-dependent mechanism of synaptopodin clustering at the post-synaptic sites

González-Gallego¹,

Konietzny²,

Pérez-Álvarez³

et al. 2019

Preprint

Self Cite

View full text Add to dashboard Cite

STATEMENTHere we demonstrate that the spine apparatus is assembled locally in dendrites. This process, which relies on the presence of synaptopodin and F-actin, is disrupted by interfering with myosin-V activity. ABSTRACTThe spine apparatus (SA) is an endoplasmic reticulum-related organelle which is present in a subset of dendritic spines in cortical and pyramidal neurons. The synaptopodin protein localizes between the stacks of the spine apparatus and is essential for the formation of this unique organelle. Although several studies have demonstrated the significance of the SA and synaptopodin in calcium homeostasis and plasticity of dendritic spines, it is still unclear what factors contribute to its stability at the synapse and whether the SA is locally formed or it is actively delivered to the spines. In this study we show that synaptopodin clusters are stable at their locations. We found no evidence of active microtubule-based transport for synaptopodin. Instead new clusters were emerging in the spines, which we interpret as the SA being assembled on-site.Furthermore, using super-resolution microscopy we show a tight association of synaptopodin with actin filaments. We identify the actin-based motor proteins myosin V and VI as novel interaction partners of synaptopodin and demonstrate that myosin V is important for the formation and/or maintenance of the SA.

show abstract

A Jacob/Nsmf Gene Knockout Results in Hippocampal Dysplasia and Impaired BDNF Signaling in Dendritogenesis

Cited by 40 publications

References 62 publications

Posttranslational modification impact on the mechanism by which amyloid‐β induces synaptic dysfunction

Posttranslational modification impact on the mechanism by which amyloid‐β induces synaptic dysfunction

Preventing Jacob-induced transcriptional inactivation of CREB protects synapses from β-amyloid in Alzheimer’s Disease

Characterization of neuronal synaptopodin reveals a myosin V-dependent mechanism of synaptopodin clustering at the post-synaptic sites

Contact Info

Product

Resources

About