A migratory lifestyle is associated with shorter telomeres in a songbird (<i>Junco hyemalis</i>)

Bauer, Carolyn M.; Heidinger, Britt J.; Ketterson, Ellen D.; Greives, Timothy J.

doi:10.1642/auk-16-56.1

Cited by 20 publications

(33 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…() and Bauer et al. () both found that individuals investing in migration also had shorter telomeres at the end of migration, perhaps as a trade‐off between investment in migration (and associated migration success) and physiological maintenance (and associated telomere dynamics). It may also be the case in this study that we are witnessing a trade‐off, with a greater investment in physiological preparedness for life at sea coming at an increased cost in terms of pre‐migratory telomere attrition.…”

Section: Discussionmentioning

confidence: 99%

“…In support of this, Angelier, Vleck, Holberton, and Marra () reported that American redstarts ( Setophaga ruticilla ) with a longer telomere length pre‐migration had a greater chance of returning from that migration, suggesting that telomere length may be a good biological indicator in which to study an individual's physiological fitness and the probability of successful migration. In contrast, studies on post‐migration telomere length in the common tern ( Sterna hirundo ) and the dark‐eyed junco ( Junco hyemalis ) found that investing in migration came at a cost to post‐migration telomere length (Bauch, Becker, & Verhulst, ; Bauer, Heidinger, Ketterson, & Greives, ). This counter‐intuitive relationship may have arisen because of a trade‐off between investment in migration (and associated migration success) versus investment in physiological maintenance (i.e.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Shorter juvenile telomere length is associated with higher survival to spawning in migratory Atlantic salmon

et al. 2017

View full text Add to dashboard Cite

Abstract1. The risk of mortality associated with a long-distance migration will depend on an animal's physiological state, as well as the prevailing ecological conditions. Here, we assess whether juvenile telomere length, which in endotherms has been shown to be a biomarker of physiological state and expected life span, predicts whether wild Atlantic salmon Salmo salar successfully complete their marine migration.2. Over 1,800 juvenile fish were trapped, measured, passive integrated transponder tagged and a tissue biopsy taken when migrating as juveniles down-river towards the sea. Survivors of the marine phase of the life cycle were then re-trapped and re-sampled when returning to the river to spawn as sexually mature adults, 1.5-2.5 years later. Most individuals experienced a reduction in telomere length during the marine migratory phase of their life cycle. While the relative rate of telomere loss was greater in males than females, telomere loss was unrelated to growth at sea.3. Contrary to expectations, salmon that had the shortest telomeres at the time of the outward migration had the greatest probability of surviving through to the return migration. This effect, independent of body size, may indicate a trade-off between investment in readiness for marine life (which favours high glucocorticoid levels, known to increase telomere attrition in other vertebrate species) and investment in telomere maintenance. Survival was also significantly influenced by the seasonal timing of outward migration, with the fish migrating downstream earliest in the spring having the highest probability of return.4. This study reveals that telomere length is associated with survival, although in ways that contrast with patterns seen in endotherms. This illustrates that while telomeres may be universally important for chromosome protection, the potential for telomere dynamics to predict performance may vary across taxa. K E Y W O R D Sfish, migration, physiological state, Salmo salar, sex effects, smoltThis is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Shorter juvenile telomere length is associated with higher survival to spawning in migratory Atlantic salmon

et al. 2017

View full text Add to dashboard Cite

show abstract

“…Quantitative PCR (qPCR) was used to measure relative telomere length in extracted samples with respect to a single‐copy control gene (glyceraldehyde‐3‐phosphate dehydrogenase, GAPDH ) (Criscuolo et al, ), following methods adapted for the dark‐eyed Junco (Bauer et al, ). GAPDH primer sequences were as follows: forward GAPDH (5’‐AACCAGCCAAGTACGATGACAT‐3′) and reverse GAPDH (5′‐CCATCAGCAGCAGCCTTCA‐3′).…”

Section: Methodsmentioning

confidence: 99%

“…A standard curve (40, 20, 10, 5 and 2.5 ng) from a single reference sample was run in triplicate on every plate to control for interplate variation (Schmidt et al, ). These values were chosen because they consistently produce reactions with optimal efficiencies (Bauer et al, ; Schmidt et al, ). The curve was made by mixing red blood cell samples from six one‐year‐old male dark‐eyed juncos and extracting DNA from the pooled sample four times.…”

Section: Methodsmentioning

confidence: 99%

Early‐breeding females experience greater telomere loss

et al. 2019

Self Cite

View full text Add to dashboard Cite

Annual reproductive success is often highest in individuals that initiate breeding early, yet relatively few individuals start breeding during this apparently optimal time. This suggests that individuals, particularly females who ultimately dictate when offspring are born, incur costs by initiating reproduction early in the season. We hypothesized that increases in the ageing rate of somatic cells may be one such cost. Telomeres, the repetitive DNA sequences on the ends of chromosomes, may be good proxies of biological wear and tear as they shorten with age and in response to stress. Using historical data from a long‐term study population of dark‐eyed juncos (Junco hyemalis), we found that telomere loss between years was greater in earlier breeding females, regardless of chronological age. There was no relationship between telomere loss and the annual number of eggs laid or chicks that reached independence. However, telomere loss was greater when temperatures were cooler, and cooler temperatures generally occur early in the season. This suggests that environmental conditions could be the primary cause of accelerated telomere loss in early breeders.

show abstract

“…Thus, tropical and temperate male stonechats engage similarly in costly mating behaviors which may potentially affect telomere length. Thus, differences between populations and taxa in breeding altitude and migratory strategy may have confounded our results as they may affect telomere dynamics(Bauer, Heidinger, Ketterson, & Greives, 2016;Stier et al, 2016). To determine whether lower mortality in benign tropical environments favors selective disappearance of individuals with short telomeres, studies in populations, in which the age of adult individuals is known, are needed.In this study, samples from different age classes were collected from different individuals.…”

mentioning

confidence: 99%

Divergent patterns of telomere shortening in tropical compared to temperate stonechats

Apfelbeck

Haussmann

Boner

et al. 2018

Ecology and Evolution

View full text Add to dashboard Cite

Telomeres have emerged as important biomarkers of health and senescence as they predict chances of survival in various species. Tropical birds live in more benign environments with lower extrinsic mortality and higher juvenile and adult survival than temperate birds. Therefore, telomere biology may play a more important role in tropical compared to temperate birds. We measured mean telomere length of male stonechats (Saxicola spp.) at four age classes from tropical African and temperate European breeding regions. Tropical and temperate stonechats had similarly long telomeres as nestlings. However, while in tropical stonechats pre‐breeding first‐years had longer telomeres than nestlings, in temperate stonechats pre‐breeding first‐years had shorter telomeres than nestlings. During their first breeding season, telomere length was again similar between tropical and temperate stonechats. These patterns may indicate differential survival of high‐quality juveniles in tropical environments. Alternatively, more favorable environmental conditions, that is, extended parental care, may enable tropical juveniles to minimize telomere shortening. As suggested by previous studies, our results imply that variation in life history and life span may be reflected in different patterns of telomere shortening rather than telomere length. Our data provide first evidence that distinct selective pressures in tropical and temperate environments may be reflected in diverging patterns of telomere loss in birds.

show abstract

A migratory lifestyle is associated with shorter telomeres in a songbird (Junco hyemalis)

Cited by 20 publications

References 28 publications

Shorter juvenile telomere length is associated with higher survival to spawning in migratory Atlantic salmon

Shorter juvenile telomere length is associated with higher survival to spawning in migratory Atlantic salmon

Early‐breeding females experience greater telomere loss

Divergent patterns of telomere shortening in tropical compared to temperate stonechats

Contact Info

Product

Resources

About