A new mouse model to study restoration of interleukin-6 (IL-6) expression in a Cre-dependent manner: microglial IL-6 regulation of experimental autoimmune encephalomyelitis

Abstract

Background Interleukin-6 (IL-6) is a pleiotropic cytokine that controls numerous physiological processes both in basal and neuroinflammatory conditions, including the inflammatory response to experimental autoimmune encephalomyelitis (EAE). IL-6 is produced by multiple peripheral and central cells, and until now, the putative roles of IL-6 from different cell types have been evaluated through conditional cell-specific IL-6 knockout mice. Nevertheless, these mice probably undergo compensatory responses of IL-6 from other cells, which makes it difficult to assess the role of each source of IL-6. Methods To give some insight into this problem, we have produced a novel mouse model: a conditional reversible IL-6 KO mouse (IL6-DIO-KO). By using double-inverted, open-reading-frame (DIO) technology, we created a mouse line with the loss of Il6 expression in all cells that can be restored by the action of Cre recombinase. Since microglia are one of the most important sources and targets of IL-6 into the central nervous system, we have recovered microglial Il6 expression in IL6-DIO-KO mice through breeding to Cx3cr1-CreER mice and subsequent injection of tamoxifen (TAM) when mice were 10–16 weeks old. Then, they were immunized with myelin oligodendrocyte glycoprotein 35-55 peptide (MOG35-55) 7 weeks after TAM treatment to induce EAE. Clinical symptoms and demyelination, CD3 infiltration, and gliosis in the spinal cord were evaluated. Results IL6-DIO-KO mice were resistant to EAE, validating the new model. Restoration of microglial Il6 was sufficient to develop a mild version of EAE-related clinical symptoms and neuropathology. Conclusions IL6-DIO-KO mouse is an excellent model to understand in detail the role of specific cellular sources of IL-6 within a recovery-of-function paradigm in EAE.

Microglial response promotes neurodegeneration in the Ndufs4 KO mouse model of Leigh syndrome

“…The parental mice strains used in this study were Ndufs4 +/− (Kruse et al, 2008) and Il6 −/− mice; the latter were generated in our laboratory (Sanchis, Fernández‐Gayol, Comes, et al, 2020). Both mouse lines were backcrossed with a C57BL/6 background for at least 10 generations.…”

“…For DNA extraction, the tails were boiled in 100 μl of 50 mM NaOH solution for 7 min. The following primers were used:5′‐AGCCTGTTCTCATACCTCGG‐3′, 5′‐GTCCTCTATGAGGGTACAGAG‐3′, and 5′‐GGTGCATACTTATACTACTAGTAG‐3′ for Ndufs4 genotyping; 5′‐GAGACTGTGAGAGAGGAGTGTG‐3′, 5′‐CATCTTATCTGGGCTGACCCTAG‐3′, and 5′‐TCTCTGCTGGGATCTAGGGCC‐3′ for IL‐6 deficiency (Sanchis, Fernández‐Gayol, Comes, et al, 2020).…”

“…For the PLX3397 experiments, both male and female mice were included in similar proportions and analyzed together (no sex effect was detected). Regarding double deficiency experiments, male and female mice were separately analyzed since IL‐6 has been described to exert sex‐dependent effects in some neurodegenerative diseases (Miller et al, 2010; Sanchis, Fernández‐Gayol, Comes, et al, 2020). For tidal volume, respiratory frequency, and multiplex results, the sexes were analyzed together owing to a lower number of experimental animals and similar results for both sexes in these variables.…”

Delimiting MOGAD as a disease entity using translational imaging

“…In EAE, the involvement of IL-6 has been extensively studied. It has been shown that IL-6 (conditionally) deficient mice are resistant to EAE ( 219 – 221 ), that IL-6 is involved in the induction phase of EAE ( 222 ) (MOG 35−55 induced), that IL-6 inhibits T cell conversion to the Treg phenotype (Foxp3+) ( 223 ), and is ( 224 , 225 ) or is not ( 223 ) involved in conversion to Th17 type T cells. It has been shown that tissue damage occurs preferentially at sites of IL-6 production ( 226 , 227 ) and that induced antibodies against IL-6 are protective against EAE ( 228 ).…”

Combined Therapy of Probiotic Microcapsules and Bomidin in Vibrio parahaemolyticus–Infected Rats

“…IL-6, a cytokine with a wide range of biological effects, can be secreted by macrophages, fibroblasts, T lymphocytes, and other cells [31]. IL-6 controls many physiological processes under basic and neuroinflammatory conditions [32,33]. The therapeutic effects of microencapsulated Lacticaseibacillus casei CGMCC1.8727, free probiotics, and combined drugs were compared.…”