A novel insertion and deletion mutation in the BHLHA9 underlies polydactyly and mesoaxial synostotic syndactyly with phalangeal reduction

Ullah, Asmat; Ali, Raheel; Majeed, Ayesha Isani; Liaqat, Khurram; Shah, Pashmina Wiqar; Khan, Bushra; Bilal, Muhammad; Umair, Muhammad; Ahmad, Wasim

doi:10.1016/j.ejmg.2018.08.005

Cited by 9 publications

(8 citation statements)

References 6 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…, but unlike two previous frameshift mutations reported by Khan et al, (c.409-409delC)12 and Ullah et al, (c.252_270delinsGCA),11 the affected individuals presented in this study (c.74_74delG) showed no clinical features of polydactyly (Table2). Previously, mutations reported in this gene in families of Pakistani, Turkish, Indian, and Italian origin, and this study is the first mutation reported in a family with Iranian origin.…”

contrasting

confidence: 81%

Whole exome sequencing identified a novel frameshift variant in the BHLHA9 in an Iranian family with mesoaxial synostotic syndactyly

Sedighzadeh

Sedaghat

Zamani

et al. 2021

Congenital Anomalies

View full text Add to dashboard Cite

Mesoaxial synostotic syndactyly with phalangeal reduction (MSSD) represents a rare non-syndromic defect with an autosomal recessive pattern of inheritance. Sequence variants in the BHLHA9 gene cause MSSD and to date only a few mutations in this gene have been reported. In the present report, we have described a consanguineous Iranian family segregating MSSD in an autosomal recessive manner. The family had two affected siblings showing evidence of camptodactyly in some fingers, complete syndactyly of the 3rd and 4th fingers with synostoses of the corresponding metacarpals, and associated single phalanx in both right and left hand. Whole exome sequencing (WES) followed by segregation analysis using Sanger sequencing identified a novel homozygous frameshift variation [c.74_74delG p.(G25Afs*55)] in the BHLHA9 gene. This has expanded the spectrum of mutations in the BHLHA9 and will facilitate genetic counseling in Iranian families segregating MSSD-related phenotypes.

show abstract

contrasting

confidence: 81%

Whole exome sequencing identified a novel frameshift variant in the BHLHA9 in an Iranian family with mesoaxial synostotic syndactyly

Sedighzadeh

Sedaghat

Zamani

et al. 2021

Congenital Anomalies

View full text Add to dashboard Cite

show abstract

“…The proband showed all these features but also bilateral clinodactyly of the fourth toe. Clinical features are variable in MSSD, such as the presence of polydactyly (Khan, Arshad, Majeed, Ullah, & Ahmad, ; Ullah et al, ), or unilaterally affected limbs (Khan et al, ; Khan, Wang, Han, Ahmad, & Zhang, ), or from unaffected feet to complete webbing. This clinical variability correlates well with that observed in the bhlha9 null mice where there was a high degree of penetrance (93%) but different degrees of syndactyly.…”

Section: Discussionmentioning

confidence: 99%

“…Three of the missense variants, p.(Asn71Asp), p.(Arg73Pro), p.(Arg75Leu), are localized in the DNA binding domain of BHLHA9 (Malik et al, ) and one in the HLH domain, p.(Ile104Thr) (Khan et al, ). Recently, the first homozygous frameshift variants, p.(Phe85Glufs*108), located in the dimerization domain (Ullah et al, ) and p.(His137Thrfs*61) in the C‐terminal region (Khan et al, ), were reported. In the present study we report, for the first time, two novel heterozygous BHLHA9 mutations, p.(Lys76*) and p.(Arg90Pro), in a patient with clinical and radiologically compatible MSSD.…”

Section: Discussionmentioning

confidence: 99%

First case of compound heterozygous BHLHA9 variants in mesoaxial synostotic syndactyly with phalangeal reduction

Díaz‐González

Parrón‐Pajares

Barcia‐Ramirez

et al. 2020

American J of Med Genetics Pt A

View full text Add to dashboard Cite

Mesoaxial synostotic syndactyly with phalangeal reduction (MSSD) is an extremely rare autosomal recessive limb abnormality characterized by the fusion of third and fourth fingers. To date, only homozygous missense and frameshift mutations have been reported in BHLHA9 associated to MSSD. In this study, we report a patient who presented with clinical and radiological features of MSSD. A customized skeletal dysplasia NGS panel revealed the presence of two novel compounds heterozygous variants in BHLHA9: NM_001164405.1: c.[226A>T][269G>C]; p.[(Lys76*)][(Arg90Pro)]. Thus, this is the first case of MSSD in a nonconsanguineous family.

show abstract

“…5 Homozygous missense or frameshift mutations in the BHLHA9 have been reported to be associated with mesoaxial synostotic syndactyly. 6,7 Mutations in the zincfinger domain (ZFD) of GLI3 can cause syndactyly and polydactyly wth phenotypic variability. 8 Moreover, GLI1, CREBBP, FGFR2, GJA1, LRP4, LMBR1, FAM58A and HOX genes are also involved with hereditary limb malformations.…”

Section: Introductionmentioning

confidence: 99%

“…Point mutations of ZRS (zone of polarizing activity regulatory sequence) and pre‐ ZRS can lead to a variable phenotype of polydactyly or syndactyly 5 . Homozygous missense or frameshift mutations in the BHLHA9 have been reported to be associated with mesoaxial synostotic syndactyly 6,7 . Mutations in the zinc‐finger domain (ZFD) of GLI3 can cause syndactyly and polydactyly wth phenotypic variability 8 .…”

Section: Introductionmentioning

confidence: 99%

Nonframeshifting indel variations in polyalanine repeat of HOXD13 gene underlies hereditary limb malformation for two Chinese families

Wang

et al. 2021

Developmental Dynamics

View full text Add to dashboard Cite

Background: Polydactyly and syndactyly are the most common hereditary limb malformations. Molecular genetic testing is of great significance for hereditary limb malformations, which can establish prognosis and recurrence risk of surgical intervention.Methods: The present study aimed to identify the genetic etiologies of a threegeneration family with postaxial polydactyly and a four-generation family with postaxial syndactyly. Whole exome sequencing was used, followed by standard mutation screening procedure, Sanger sequencing and bioinformatics analysis. Results: Two nonframeshifting insertion/deletion (indel) mutations in HOXD13 (c.206_207ins AGCGGCGGCTGCGGCGGCGGCGGC:p.A68insAAAAAAAA or c.171_182delGGCGGCGGCGGC: p.56_60delAAAA) were successfully identified as the pathogenic mutation. The two nonframeshifting indel mutations led to truncation or expansion of homopolymeric alanine (Poly-Ala) repeats of HOXD13 proteins. Sequence alignment of HOXD13 protein among many different species for Poly-Ala position is highly conserved. Hypothetical three-dimensional (3-D) structural analysis further showed mutant HOXD13 proteins (p.A68insAAAAAAAA and p.56_60delAAAA) converted the disordered fragment into a short β-strand (residues 63-68 or residues 64-68), thereby forming a conformational change.Conclusions: The present study identified two nonframeshifting mutations of HOXD13 polyalanine repeat location in two Chinese families with postaxial polydactyly or postaxial syndactyly. Our results also provide new insights into genetic counseling and clinical management.

show abstract

A novel insertion and deletion mutation in the BHLHA9 underlies polydactyly and mesoaxial synostotic syndactyly with phalangeal reduction

Cited by 9 publications

References 6 publications

Whole exome sequencing identified a novel frameshift variant in the BHLHA9 in an Iranian family with mesoaxial synostotic syndactyly

Whole exome sequencing identified a novel frameshift variant in the BHLHA9 in an Iranian family with mesoaxial synostotic syndactyly

First case of compound heterozygous BHLHA9 variants in mesoaxial synostotic syndactyly with phalangeal reduction

Nonframeshifting indel variations in polyalanine repeat of HOXD13 gene underlies hereditary limb malformation for two Chinese families

Contact Info

Product

Resources

About