A Novel Lateral Flow Assay for Rapid and Sensitive Nucleic Acid Detection of Avibacterium paragallinarum

Abstract

Avibacterium paragallinarum, the pathogen of infectious coryza, caused a highly contagious respiratory disease that poses a serious threat to chickens. Hence, it is necessary to do diagnostic screening for Av. paragallinarum. Existing technologies have been used for Av. paragallinarum testing, which, however, have some drawbacks such as time consuming and expensive that require well-trained personnel and sophisticated infrastructure, especially when they are limitedly feasible in some places for lack of resources. Nucleic acid hybridization-based lateral flow assay (LFA) is capable of dealing with these drawbacks, which is attributed to the advantages, such low cost, rapid, and simple. However, nucleic acid determination of Av. paragallinarum through LFA method has not been reported so far. In this study, we developed a novel LFA method that employed gold nanoparticle probes to detect amplified Av. paragallinarum dsDNA. Compared with agarose gel electrophoresis, this LFA strip was inexpensive, simple- to- use, and time- saving, which displayed the visual results within 5–8 min. This LFA strip had higher sensitivity that achieved the detection limit of 101 CFU/ml compared with 102 CFU/ml in agarose gel electrophoresis. Besides, great sensitivity was also shown in the LFA strip, and no cross reaction existed for other bacteria. Furthermore, Av. paragallinarum in clinical chickens with infectious coryza were perfectly detected by our established LFA strip. Our study is the first to develop the LFA integrated with amplification and sample preparation techniques for better nucleic acid detection of Av. paragallinarum, which holds great potential for rapid, accurate, and on-site determination methods for early diagnosis of Av. paragallinarum to control further spreading.

HutZ is required for efficient heme utilization and contributes to the pathogenicity of Avibacterium paragallinarum

“…Finally, the bacteria in SOC were centrifuged and cultured in TSA plate supplemented with 2 µg/mL Cm. The bacterial colony grown on the plate was determined by PCR, and the procedures could be referred to as previously described ( 39 ). The primer sequences were as follows: F: 5′- AAAGTGAGCGTGGCTTATCAATTCT -3′; R: 5′- AAGCTCACACATAAGGCTGAGTAATAAAT-3′.…”

Lateral Flow Immunoassay of SARS-CoV-2 Antigen with SERS-Based Registration: Development and Comparison with Traditional Immunoassays

“…The effectiveness of the implementation of SERS nanotags in LFIA tests for the detection of various analytes was evaluated in a review by Khlebtsov et al [ 15 ]. The SERS-based LFIAs were successfully applied for quantitative detection of antibiotics [ 19 ], biomarkers [ 20 , 21 , 22 , 23 ], allergens [ 24 ], pathogens [ 25 , 26 ], and so on. To date, only a few researchers have proposed the integration of SERS nanotags with LFIA to improve the efficiency of COVID-19 diagnostics through serological IgM and IgG testing [ 18 , 27 ], whereas in the case of SARS-CoV-2 antigen detection, the SERS technique was not earlier applied.…”