A novel strategy to over-express and purify homologous proteins from Streptococcus pneumoniae

Sapio, Morena Lo; Hilleringmann, Markus; Barocchi, Michèle A.; Moschioni, Monica

doi:10.1016/j.jbiotec.2011.11.011

Cited by 12 publications

(16 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…To construct plasmid pMU-P96-flag-locZ, the P96 promoter was amplified with primer LN231 and LN215 from a template plasmid pMU1328 [51]. The flag-locZ fragment was amplified with primers NS3 and NS4 using pZn-flag-locZ as a template.…”

Section: Methodsmentioning

confidence: 99%

Characterization of pneumococcal Ser/Thr protein phosphatase phpP mutant and identification of a novel PhpP substrate, putative RNA binding protein Jag

et al. 2016

View full text Add to dashboard Cite

BackgroundReversible protein phosphorylation catalyzed by protein kinases and phosphatases is the primary mechanism for signal transduction in all living organisms. Streptococcus pneumoniae encodes a single Ser/Thr protein kinase, StkP, which plays a role in virulence, stress resistance and the regulation of cell wall synthesis and cell division. However, the role of its cognate phosphatase, PhpP, is not well defined.ResultsHere, we report the successful construction of a ΔphpP mutant in the unencapsulated S. pneumoniae Rx1 strain and the characterization of its phenotype. We demonstrate that PhpP negatively controls the level of protein phosphorylation in S. pneumoniae both by direct dephosphorylation of target proteins and by dephosphorylation of its cognate kinase, StkP. Catalytic inactivation or absence of PhpP resulted in the hyperphosphorylation of StkP substrates and specific phenotypic changes, including sensitivity to environmental stresses and competence deficiency. The morphology of the ΔphpP cells resembled the StkP overexpression phenotype and conversely, overexpression of PhpP resulted in cell elongation mimicking the stkP null phenotype. Proteomic analysis of the phpP knock-out strain permitted identification of a novel StkP/PhpP substrate, Spr1851, a putative RNA-binding protein homologous to Jag. Here, we show that pneumococcal Jag is phosphorylated on Thr89. Inactivation of jag confers a phenotype similar to the phpP mutant strain.ConclusionsOur results suggest that PhpP and StkP cooperatively regulate cell division of S. pneumoniae and phosphorylate putative RNA binding protein Jag.Electronic supplementary materialThe online version of this article (doi:10.1186/s12866-016-0865-6) contains supplementary material, which is available to authorized users.

show abstract

Section: Methodsmentioning

confidence: 99%

Characterization of pneumococcal Ser/Thr protein phosphatase phpP mutant and identification of a novel PhpP substrate, putative RNA binding protein Jag

et al. 2016

View full text Add to dashboard Cite

show abstract

“…The pMU1328 recombinant plasmid (pMU1328-Pc_rlrA)17 was obtained as previously described18. Briefly, the rlrA gene was amplified on the TIGR4 genomic DNA ( rlrA Forward GTGCGTGGATCCATGCTAAACAAATACATTGAAAAA, rlrA Reverse CAGCGTGTCGACCTTTTTGTGTGTAGACAGTACGAT), while the erythromycin resistance (ermB) constitutive promoter ( Pc ) was amplified on the pMU1328 plasmid (Pc Forward GTGCGTGAATTCGAAACAGCAAAGAATGGCGGAAAC, Pc Reverse CAGCGTGGATCCGTAATCACTCCTTCTTAATTACAA).…”

Section: Methodsmentioning

confidence: 99%

Expression of the Streptococcus pneumoniae pilus-1 undergoes on and off switching during colonization in mice

Pancotto

Angelis

Bizzarri

et al. 2013

Sci Rep

Self Cite

View full text Add to dashboard Cite

Streptococcus pneumoniae pili contribute to adherence and virulence. The regulation of pilus-1 expression is bistable, thus piliated strains contain a variable proportion of pilus-1-non-expressing bacteria. We investigated whether such proportion changes during colonization. Pilus-1-expressing bacteria were quantified in nasopharyngeal washes and pharyngeal tissues from mice that received intranasally bacterial populations with high (H), medium (M) or low (L) pilus-1 expression rates. In nasopharyngeal washes, at early colonization stages, pilus-1 expression rates decreased in H population, while increased in L and M; at later stages, expression rates decreased or remained low. Similar trends were observed in pharyngeal tissues, where, however, at late stages the expression rates were medium-high. In conclusion, pilus-1 is preferentially expressed at early colonization stages, consistently with its role in adhesion, while at later stages the expression is partially switched off. Pilus-1 expression rates observed in clinical isolates in vitro may not reflect the actual rates during colonization/infection.

show abstract

“…The second complementation strain Sp338 (DpynA pMU-pynA-flag) was prepared by ectopic expression of the pynA gene under the control of the constitutive promoter P 96 from plasmid pMU1328 [19]. The second complementation strain Sp338 (DpynA pMU-pynA-flag) was prepared by ectopic expression of the pynA gene under the control of the constitutive promoter P 96 from plasmid pMU1328 [19].…”

Section: Protein Conservation and Genomic Contextmentioning

confidence: 99%

“…The P 96 promoter was amplified with the primers LN215 and LN231 from the template plasmid pMU1328 [19]. First, pynA was amplified with the primers AU119 and AU120 using Sp238 (pynA-flag) chromosomal DNA as a template.…”

Section: Construction Of Ectopic Complementation and Overexpression Smentioning

confidence: 99%

“…First, we reverted the DpynA mutation to the WT genotype by transforming the WT allele of the pynA gene fused with a flag-tag into the DpynA strain (Sp238). The second complementation strain Sp338 (DpynA pMU-pynA-flag) was prepared by ectopic expression of the pynA gene under the control of the constitutive promoter P 96 from plasmid pMU1328 [19]. The expression of PynA-FLAG in the resulting complementation strains was monitored by immunoblotting ( Fig.…”

Section: Protein Conservation and Genomic Contextmentioning

confidence: 99%

See 1 more Smart Citation

PynA is a pyrimidine 5′‐nucleotidase that functions as an antimutator protein inStreptococcus pneumoniae

et al. 2019

View full text Add to dashboard Cite

Streptococcus pneumoniae is a Gram‐positive bacterium that is a major agent of community‐acquired bacterial pneumonia, meningitis and sepsis. Although the mismatch repair function of S. pneumoniae has been assigned to the hexA‐hexB gene products, an enzyme capable of the direct elimination of noncanonical nucleotides from the cytoplasm has not been described for this bacterium. Our results show that Spr1057, a protein with previously unknown function, is involved in the inactivation of mutagenic pyrimidine nucleotides and was accordingly designated PynA (pyrimidine nucleotidase A). Biochemical assays confirmed the phosphatase activity of the recombinant enzyme and revealed its metal ion dependence for optimal enzyme activity. We demonstrated that PynA forms a homodimer with higher in vitro activity towards noncanonical 5‐fluoro‐2′‐deoxyuridine monophosphate than towards canonical thymidine monophosphate. Furthermore, we showed via in vivo assays that PynA protects cells against noncanonical pyrimidine derivatives such as 5‐fluoro‐2′‐deoxyuridine and prevents the incorporation of the potentially mutagenic 5‐bromo‐2′‐deoxyuridine (5‐BrdU) into DNA. Fluctuation analysis performed under S. pneumoniae exposure to 5‐BrdU revealed that the pynA null strain accumulates random mutations with high frequency, resulting in a 30‐fold increase in the mutation rate. The data support a model in which PynA, a protein conserved in other Gram‐positive bacteria, functions as a house‐cleaning enzyme by selectively eliminating noncanonical nucleotides and maintaining the purity of dNTP pools, similar to the YjjG protein described for Escherichia coli.

show abstract

A novel strategy to over-express and purify homologous proteins from Streptococcus pneumoniae

Cited by 12 publications

References 38 publications

Characterization of pneumococcal Ser/Thr protein phosphatase phpP mutant and identification of a novel PhpP substrate, putative RNA binding protein Jag

Characterization of pneumococcal Ser/Thr protein phosphatase phpP mutant and identification of a novel PhpP substrate, putative RNA binding protein Jag

Expression of the Streptococcus pneumoniae pilus-1 undergoes on and off switching during colonization in mice

PynA is a pyrimidine 5′‐nucleotidase that functions as an antimutator protein inStreptococcus pneumoniae

Contact Info

Product

Resources

About