A rapid MZI-IDA sensor system for EGFR mutation testing in non-small cell lung cancer (NSCLC)

Liu, Qing; Lim, Swee Yin; Soo, Ross A.; Park, Mi Kyoung; Shin, Yong Moon

doi:10.1016/j.bios.2015.07.055

Cited by 24 publications

(9 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Carboxyl-terminated genome (5′ COOH-C6-CAGCAGTTTGGCCCGCCCAAAA 3′) was used as a probe for DNA immobilization. The complementary mutant strand (5′ TTTTGGGCGGGCCAAACTGCTG 3′), single base pair mismatch strand (5′ TTTTGGGCTGGCCAAACTGCTG 3′) and non-complementary strand (5′ CAGCAGTTTGGCCCGCCCAAAA 3′) were used as targets in the detection strategies 20 .…”

Section: Methodsmentioning

confidence: 99%

“…In the last decade, the application of biosensors in the detection of blood biomarkers, and proteins have received high attention in the diagnosis of various diseases 18,19 . Apart from the lab-based equipment, biosensors with inexpensive inventing technology and low consumption of clinical samples are highly welcomed as the easier clinical diagnostic tool 20,21 . Presently, there is a huge interest in the invention of genosensor for the detection of highly sensitive DNA.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Aluminosilicate Nanocomposite on Genosensor: A Prospective Voltammetry Platform for Epidermal Growth Factor Receptor Mutant Analysis in Non-small Cell Lung Cancer

Ramanathan

Arshad

Poopalan

et al. 2019

Sci Rep

View full text Add to dashboard Cite

Lung cancer is one of the most serious threats to human where 85% of lethal death caused by non-small cell lung cancer (NSCLC) induced by epidermal growth factor receptor (EGFR) mutation. The present research focuses in the development of efficient and effortless EGFR mutant detection strategy through high-performance and sensitive genosensor. The current amplified through 250 µm sized fingers between 100 µm aluminium electrodes indicates the voltammetry signal generated by means of the mutant DNA sequence hybridization. To enhance the DNA immobilization and hybridization, ∼25 nm sized aluminosilicate nanocomposite synthesized from the disposed joss fly ash was deposited on the gaps between aluminium electrodes. The probe, mutant (complementary), and wild (single-base pair mismatch) targets were designed precisely from the genomic sequences denote the detection of EGFR mutation. Fourier-transform Infrared Spectroscopy analysis was performed at every step of surface functionalization evidences the relevant chemical bonding of biomolecules on the genosensor as duplex DNA with peak response at 1150 cm−1 to 1650 cm−1. Genosensor depicts a sensitive EGFR mutation as it is able to detect apparently at 100 aM mutant against 1 µM DNA probe. The insignificant voltammetry signal generated with wild type strand emphasizes the specificity of genosensor in the detection of single base pair mismatch. The inefficiency of genosensor in detecting EGFR mutation in the absence of aluminosilicate nanocomposite implies the insensitivity of genosensing DNA hybridization and accentuates the significance of aluminosilicate. Based on the slope of the calibration curve, the attained sensitivity of aluminosilicate modified genosensor was 3.02E-4 A M−1. The detection limit of genosensor computed based on 3σ calculation, relative to the change of current proportional to the logarithm of mutant concentration is at 100 aM.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Aluminosilicate Nanocomposite on Genosensor: A Prospective Voltammetry Platform for Epidermal Growth Factor Receptor Mutant Analysis in Non-small Cell Lung Cancer

Ramanathan

Arshad

Poopalan

et al. 2019

Sci Rep

View full text Add to dashboard Cite

show abstract

“…By evaluating 70 cases of colorectal cancer, ISAD-KRAS detected even cases where PCR and direct sequencing did not have sufficient sensitivity. A similar approach was followed by Liu et al (2015b) to identify punctual mutations in the EGFR gene, specifically, the L858R mutation. They identified 1% of mutant alleles in a sample of mixed cellular types in contrast with the 25% achieved by PCR.…”

Section: Applications For Clinical Diagnosismentioning

confidence: 99%

Advanced Evanescent-Wave Optical Biosensors for the Detection of Nucleic Acids: An Analytic Perspective

et al. 2019

View full text Add to dashboard Cite

Evanescent-wave optical biosensors have become an attractive alternative for the screening of nucleic acids in the clinical context. They possess highly sensitive transducers able to perform detection of a wide range of nucleic acid-based biomarkers without the need of any label or marker. These optical biosensor platforms are very versatile, allowing the incorporation of an almost limitless range of biorecognition probes precisely and robustly adhered to the sensor surface by covalent surface chemistry approaches. In addition, their application can be further enhanced by their combination with different processes, thanks to their integration with complex and automated microfluidic systems, facilitating the development of multiplexed and user-friendly platforms. The objective of this work is to provide a comprehensive synopsis of cutting-edge analytical strategies based on these label-free optical biosensors able to deal with the drawbacks related to DNA and RNA detection, from single point mutations assays and epigenetic alterations, to bacterial infections. Several plasmonic and silicon photonic-based biosensors are described together with their most recent applications in this area. We also identify and analyse the main challenges faced when attempting to harness this technology and how several innovative approaches introduced in the last years manage those issues, including the use of new biorecognition probes, surface functionalization approaches, signal amplification and enhancement strategies, as well as, sophisticated microfluidic solutions.

show abstract

“…Another important target for biosensor detection is the “epidermal growth factor receptor” (EGFR); the detection of the mutation of this protein provides valuable information for the detection and the management of non-small cell lung cancer [17]. The detection of ThFR mutations has been demonstrated with an integrated optical device incorporating the DNA sequence related to genetic mutation [18]. The overall detection, including the DNA amplification, is characterized by a limit of detection of 0.125 pg/µL, at least one order of magnitude smaller than the conventional analysis.…”

Section: Biosensors For Biomarkersmentioning

confidence: 99%

Sensors for Lung Cancer Diagnosis

Capuano

Catini

Paolesse

et al. 2019

JCM

View full text Add to dashboard Cite

The positive outcome of lung cancer treatment is strongly related to the earliness of the diagnosis. Thus, there is a strong requirement for technologies that could provide an early detection of cancer. The concept of early diagnosis is immediately extended to large population screening, and then, it is strongly related to non-invasiveness and low cost. Sensor technology takes advantage of the microelectronics revolution, and then, it promises to develop devices sufficiently sensitive to detect lung cancer biomarkers. A number of biosensors for the detection of cancer-related proteins have been demonstrated in recent years. At the same time, the interest is growing towards the analysis of volatile metabolites that could be measured directly from the breath. In this paper, a review of the state-of-the-art of biosensors and volatile compound sensors is presented.

show abstract

A rapid MZI-IDA sensor system for EGFR mutation testing in non-small cell lung cancer (NSCLC)

Cited by 24 publications

References 32 publications

Aluminosilicate Nanocomposite on Genosensor: A Prospective Voltammetry Platform for Epidermal Growth Factor Receptor Mutant Analysis in Non-small Cell Lung Cancer

Aluminosilicate Nanocomposite on Genosensor: A Prospective Voltammetry Platform for Epidermal Growth Factor Receptor Mutant Analysis in Non-small Cell Lung Cancer

Advanced Evanescent-Wave Optical Biosensors for the Detection of Nucleic Acids: An Analytic Perspective

Sensors for Lung Cancer Diagnosis

Contact Info

Product

Resources

About