A recombinant replication-competent hepatitis C virus expressing Azami-Green, a bright green-emitting fluorescent protein, suitable for visualization of infected cells

Hou, Wei; Aoki, Chie; Li, Renjie; Xi, Wen; Xue, Yinhuan; Gao, Bin; Liu, Wenjun; Gao, George F.; Iwamoto, Aikichi; Kitamura, Yoshihiro

doi:10.1016/j.bbrc.2008.08.145

Cited by 7 publications

(6 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Data were analyzed using the comparative ΔΔCt method. Primers for detection of HCV RNA were described 29. Specific primers used included the following: DDX3X, gtggaacaaacactcgctt (sense), acctttagtagct tctcggtt (anti‐sense); DDX6, caggaacatcgaaatcgtg (sense), tccaatacgatggagatagg (anti‐sense); EIF2C2, cgg acaatcagacctcaacca (sense), cccagtcacgtctgtcatctc (anti‐sense); HSP90, acaaggatctgcagccatt (sense), gtcaagctttc ataccggatt (anti‐sense); PATL1, tcctgctccctatggtgagag (sense), catggcagcaagtggactacc (anti‐sense); and GW182, ctgaacctccctcacggaa (sense), ggctttgtgcaaagaaa cgac (anti‐sense).…”

Section: Methodsmentioning

confidence: 99%

Ethanol facilitates hepatitis C virus replication via up-regulation of GW182 and heat shock protein 90 in human hepatoma cells

et al. 2013

Self Cite

View full text Add to dashboard Cite

Alcohol use and hepatitis C virus (HCV) infection synergize to cause liver damage and microRNA-122 (miR-122) appears to play a key role in this process. Argonaute 2 (Ago2), a key component of the RNA-induced silencing complex, has been shown to be important in modulating miR-122 function during HCV infection. However, GW182, a critical component of processing bodies (GW-bodies) that is recruited by Ago2 to target mRNA has not been assessed in HCV infection. To characterize the role of GW182 in the pathogenesis of HCV infection, we determined its transcription and protein expression in an HCV J6/JFH1 culture system. Here we show that transcript and protein levels of GW182 as well as HCV RNA and protein expression increased with alcohol exposure. Specific silencing of mRNA expression by short interference (si) RNA against GW182 significantly decreased HCV RNA and protein expression. Over-expression of GW182 significantly increased HCV RNA and protein expression in HCV J6/JFH1 infected Huh-7.5 cells. Furthermore, GW182 co-localized and co-immunoprecipitated with HSP90 which increased on alcohol exposure with and without HCV infection and enhanced HCV gene expression. The use of an HSP90 inhibitor or knockdown of HSP90 decreased GW182 and miR-122 expression and significantly reduced HCV replication. Overall, our results suggest that GW182 protein that is linked to miR-122 biogenesis and HSP90, which has been shown to stabilize the RNA-induced silencing complex, are novel host proteins that regulate HCV infection during alcohol abuse.

show abstract

Section: Methodsmentioning

confidence: 99%

Ethanol facilitates hepatitis C virus replication via up-regulation of GW182 and heat shock protein 90 in human hepatoma cells

et al. 2013

Self Cite

View full text Add to dashboard Cite

show abstract

“…Data were analyzed using the comparative ΔCt method. Primers for detection of HCV RNA were described previously (Hou et al., ) . Specific primers for Cyclin G1 included: CCNG1 sense: 5′‐AGCTGCAGTCTCTG TCAAG‐3′; CCNG1 antisense: 5′‐ATGTCTCTGTGTCAAAGCCA‐3.′…”

Section: Methodsmentioning

confidence: 99%

“…Intracellular staining was performed as described previously (Hou et al., ). Confocal imaging was performed on a Leica TCS SP2 confocal microscope (Leica Microsystems, Wetzlar, Germany), and Leica confocal software was used for the acquisition of images.…”

Section: Methodsmentioning

confidence: 99%

Alcohol Facilitates HCV RNA Replication Via Up‐Regulation of miR‐122 Expression and Inhibition of Cyclin G1 in Human Hepatoma Cells

Hou

Bukong

Kodys

et al. 2012

Alcoholism Clin & Exp Res

Self Cite

View full text Add to dashboard Cite

Background Clinical studies demonstrate synergistic liver damage by alcohol and hepatitis C virus (HCV); however, the mechanisms by which alcohol promotes HCV infection remain obscure. The liver-specific microRNA-122 (miR-122) regulates HCV replication and expression of host genes, including Cyclin G1. Here, we hypothesized that alcohol regulates miR-122 expression and thereby modulates HCV RNA replication. Methods The J6/JFH/Huh-7.5 model of HCV infection was used in this study. Real-time quantitative polymerase chain reaction, Western blotting, electrophoretic mobility shift assay, and confocal microscopy were used for experimental analysis. Results We found that acute alcohol exposure (25 mM) significantly increased intracellular HCV RNA as well as miR-122 levels in Huh-7.5 and Huh-7.5/CYP2E1 expressing cells in the presence and absence of J6/JFH-HCV infection. Expression of the miR-122 target, Cyclin G1, was inhibited by alcohol both in J6/JFH-infected and uninfected Huh-7.5 cells. The use of a miR-122 inhibitor increased Cyclin G1 expression and prevented the alcohol-induced increase in HCV RNA and protein levels, suggesting a mechanistic role for alcohol-induced miR122 in HCV replication. We discovered that siRNA-mediated silencing of Cyclin G1 significantly increased intracellular HCV RNA levels compared with controls, suggesting a mechanistic role for Cyclin G1 in HCV replication. Alcohol-induced increase in miR-122 was associated with increased nuclear translocation and DNA binding of the nuclear regulatory factor-κB and could be prevented by NF-κB inhibition. Conclusions Our novel data indicate a miR-122-mediated mechanism for alcohol increasing HCV RNA replication. We show for the first time that Cyclin G1, a miR-122 target gene, has regulatory effects on HCV replication and that alcohol increases HCV replication by regulating miR-122 and Cyclin G1.

show abstract

“…Replication inhibition assay using subgenomic replicon: Methods for in vitro transcription of HCV RNA and its electroporation into cells have been reported previously (32). SGR-GLuc/JFH1 RNA-transfected cells were seeded into 12-well plates.…”

Section: Cells and Virusesmentioning

confidence: 99%

Anti-Hepatitis C Virus Activity of a Crude Extract from Longan (<i>Dimocarpus longan</i> Lour.) Leaves

et al. 2016

Self Cite

View full text Add to dashboard Cite

SUMMARY:Infection with hepatitis C virus (HCV) results in hepatitis C, a disease characterized by chronic infection, cirrhosis, and hepatocellular carcinoma. Currently, the standard therapy is a combination of pegylated interferon-a plus ribavirin with NS3 protease inhibitors. Addition of NS3 protease inhibitors to the standard therapy improves response rates; however, use of NS3 protease inhibitors is also associated with significant adverse effects and an increase in the overall cost of treatment. Therefore, there is a need to develop safe and inexpensive drugs for the treatment of HCV infections. In this study, we examined the antiviral activity of a crude extract from Dimocarpus longan leaves against HCV (genotype 2a strain JFH1). The D. longan crude extract (DL-CE) exhibited anti-HCV activity with a 50z effective concentration (EC 50 ) of 19.4 mg/ml without cytotoxicity. A time-of-addition study demonstrated that DL-CE has anti-HCV activity at both the entry and post-entry steps and markedly blocks the viral entry step through direct virucidal activity with marginal inhibition of virion assembly. Co-treatment of DL-CE with cyclosporine A, an immunosuppressant or telaprevir, an NS3 protease inhibitor, resulted in additive and synergistic antiviral effects, respectively. Our findings suggest that DL-CE may be useful as an add-on therapy candidate for treating HCV infections.

show abstract

A recombinant replication-competent hepatitis C virus expressing Azami-Green, a bright green-emitting fluorescent protein, suitable for visualization of infected cells

Cited by 7 publications

References 34 publications

Ethanol facilitates hepatitis C virus replication via up-regulation of GW182 and heat shock protein 90 in human hepatoma cells

Ethanol facilitates hepatitis C virus replication via up-regulation of GW182 and heat shock protein 90 in human hepatoma cells

Alcohol Facilitates HCV RNA Replication Via Up‐Regulation of miR‐122 Expression and Inhibition of Cyclin G1 in Human Hepatoma Cells

Anti-Hepatitis C Virus Activity of a Crude Extract from Longan (<i>Dimocarpus longan</i> Lour.) Leaves

Contact Info

Product

Resources

About