A redundant nuclear protein binding site contributes to negative regulation of the mouse mammary tumor virus long terminal repeat

Abstract

The tissue specificity of mouse mammary tumor virus (MMTV) expression is controlled by regulatory elements in the MMTV long terminal repeat (LTR). These regulatory elements include the hormone response element, located approximately between ؊200 and ؊75, as well as binding sites for NF-1, Oct-1 (OTF-1), and mammary gland enhancer factors. Naturally occurring MMTV deletion variants isolated from T-cell and kidney tumors, transgenic-mouse experiments with MMTV LTR deletions, and transient transfection assays with LTR constructs indicate that there are additional transcription regulatory elements, including a negative regulatory element (NRE), located upstream of the hormone response element. To further define this regulatory region, we have constructed a series of BAL 31 deletion mutants in the MMTV LTR for use in transient transfection assays. These assays indicated that deletion of two regions (referred to as promoter-distal and -proximal NREs) between ؊637 and ؊201 elevated basal MMTV promoter activity in the absence of glucocorticoids. The region between ؊637 and ؊264 was surveyed for the presence of nuclear protein binding sites by gel retardation assays. Only one type of protein complex (referred to as NRE-binding protein or NBP) bound exclusively to sites that mapped to the promoter-distal and -proximal NREs identified by BAL 31 mutations. The promoter-proximal binding site was mapped further by linker substitution mutations and transfection assays. Mutations that mapped to a region containing an inverted repeat beginning at ؊287 relative to the start of transcription elevated basal expression of a reporter gene driven by the MMTV LTR. A 59-bp DNA fragment from the distal NRE also bound the NBP complex. Gel retardation assays showed that mutations within both inverted repeats of the proximal NRE eliminated NBP binding and mutations within single repeats altered NBP binding. Intriguingly, the NBP complex was detected in extracts from T cells and lung cells but was absent from mammary gland cells. These results suggest that a factor contributing to high-level expression of MMTV in the mammary gland is the lack of negative regulation by NBP.

Mouse Mammary Tumor Virus Carrying a Bacterial supF Gene Has Wild-Type Pathogenicity and Enables Rapid Isolation of Proviral Integration Sites

“…1). This site is not within any known positive or negative regulatory elements or promoters of MMTV (2,17,29).…”

Mutational and Functional Analysis of the C-Terminal Region of the C3H Mouse Mammary Tumor Virus Superantigen

“…Construction and growth of plasmid constructs. Construction of the BglII substitution mutants p852, p867, p899, p909, p924, and p907/924 in the p19-LUC vector (57) was as described previously (4) except that the 907/924 mutation was CTAGATCTTAGAACATTCAGATCTG instead of GAGATCTGTAGAACA TTCAGATCTG. The pA series of deletion constructs were prepared by digesting the wild-type C3H LTR in pLC1 (43) at the AflII site (Ϫ201 relative to the start of MMTV transcription at the U3/R junction) with Bal 31 (New England Biolabs, Beverly, Mass.).…”

“…RPAs were performed as described by Yang and Dudley (66) except that hybridizations were performed at 56°C. The riboprobe contained the Sau3A fragment (Ϫ455 to Ϫ116 relative to the start of MMTV transcription) that includes the sag gene polymorphic region II (50) and the promoter proximal NRE (4).…”

“…These experiments showed that virtually all C-terminal amino acid substitutions abolished Sag function and that sag mutant viruses failed to induce tumors in injected mice. However, mutants that lacked Sag function, but had overlapping mutations in a negative regulatory element (NRE) affecting MMTV transcription (4,37), retained the ability to induce mammary tumors in mutant-injected animals. All mutants, except one that affected the C-terminal three amino acids and retained partial Sag function (HPA242), lost the ability to be transmitted through milk to susceptible offspring.…”

Mouse Mammary Tumor Virus Sequences Responsible for Activating Cellular Oncogenes

“…The constructs tested in the analysis shown in Fig. 4B remove sequences from the middle of the MMTV LTR, where regulatory elements that inhibit expression in certain nonmammary cells have been mapped (3,7,12,15,20,22,31). The ILCϩ⌬ClaI/StuI construct removes 224 bp from the MMTV promoter, from Ϫ862 to Ϫ638.…”