A rheumatoid factor transgenic mouse model of autoantibody regulation

Shlomchik, Mark J.; Zharhary, Dorit; Saunders, Thomas L.; Camper, Sally A.; Weigert, Martin

doi:10.1093/intimm/5.10.1329

Cited by 126 publications

(180 citation statements)

References 0 publications

Supporting

Mentioning

177

Contrasting

Order By: Relevance

“…Monoreactive high affinity human RF that did not encounter the Ag during ontogeny were deleted when they did encounter their Ag (hIgG) after i.p. injection (15 show fairly similar behavior to our nAAb models; these B cells are not deleted but their functional state seems to be related to a certain degree of Ag-specific activation as judged by spontaneous RF secretion (16). In our models, we do not think that the nAAb secretion is linked to Ag-specific B cell activation because we also observed IgMa secretion in tg mice lacking the tg light chain.…”

Section: Discussionsupporting

confidence: 71%

“…In contrast, if these high affinity B cells encounter the autoantigen in the periphery, they are deleted (14,15). Murine models expressing tg BCR with moderate affinity for soluble autoantigens were also studied in the case of rheumatoid factors (RF) (16) and single-stranded DNA (11); the models indicated that anergy is the main tolerance mechanism. However, in addition to the affinity of the BCR and the geography of the Ag encounter that determine the autoreactive B cell fate, the valency of the Ag also appeared critical (17), as well as the cross-reactivity (18).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Natural Autoreactive B Cells in Transgenic Mice Reproduce an Apparent Paradox to the Clonal Tolerance Theory

Koenig-Marrony

Soulas

Julien

et al. 2001

The Journal of Immunology

View full text Add to dashboard Cite

Naturally occurring autoreactive B cells are thought to be physically eliminated or rendered functionally silent through different mechanisms of tolerance. However, multireactive low affinity natural autoantibody-producing B cells seem to escape these mechanisms in normal adults and could constitute the B cell pool from which pathological autoantibodies can emerge. To analyze this apparent paradox to the clonal tolerance theory, we have made two transgenic mouse lines (μk, μ∂k) producing a natural low affinity multireactive human autoantibody. These models enable us to test both the central tolerance mechanisms (reactivity with single-stranded DNA) and the peripheral tolerance mechanisms after Ag administration. Not only are the multireactive B cells not deleted in the bone marrow, they circulate and remain in the periphery even after the prolonged administration of Ag, the presence of membrane IgD increasing the number of mature autoreactive B cells. Self-reactive B cells are shown to be autoantigen ignorant both in vivo and in vitro, but they are not anergic because they can be easily activated through both B cell receptor-dependent and -independent pathways. Thus, these mouse lines reproduce an apparent paradox to the clonal tolerance theory meriting further investigation of the biological significance of this phenomenon.

show abstract

Section: Discussionsupporting

confidence: 71%

mentioning

confidence: 99%

Natural Autoreactive B Cells in Transgenic Mice Reproduce an Apparent Paradox to the Clonal Tolerance Theory

Koenig-Marrony

Soulas

Julien

et al. 2001

The Journal of Immunology

View full text Add to dashboard Cite

show abstract

“…The host cells that do not express the Tg, and thus are positive for the endogenous IgM b marker, were also not significantly depleted. Although the exact identity of these cells is uncertain, the most likely explanation is that these rare endogenous cells (17) were expanded by environmental antigens and hence are memory cells.…”

Section: Resultsmentioning

confidence: 99%

BLyS inhibition eliminates primary B cells but leaves natural and acquired humoral immunity intact

Scholz

Crowley

Tomayko

et al. 2008

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

161

148

View full text Add to dashboard Cite

We have used an inhibiting antibody to determine whether preimmune versus antigen-experienced B cells differ in their requisites for BLyS, a cytokine that controls differentiation and survival. Whereas in vivo BLyS inhibition profoundly reduced naïve B cell numbers and primary immune responses, it had a markedly smaller effect on memory B cells and long-lived plasma cells, as well as secondary immune responses. There was heterogeneity within the memory pools, because IgM-bearing memory cells were sensitive to BLyS depletion whereas IgG-bearing memory cells were not, although both were more resistant than naïve cells. There was also heterogeneity within B1 pools, as splenic but not peritoneal B1 cells were diminished by anti-BLyS treatment, yet the number of natural antibody-secreting cells remained constant. Together, these findings show that memory B cells and natural antibodysecreting cells are BLyS-independent and suggest that these pools can be separately manipulated.

show abstract

“…To test this idea, we analyzed the V -J 2 light chain repertoires of a second distinct J558 family IgH transgenic line, also on the CB-17 background. This heavy chain, originally found to be paired with a light chain V 8 family member having rheumatoid factor specificity, was used to construct a heavy chain transgenic mouse line named Daisy (11). Immature and mature splenic B cells were sorted from this line by using a similar protocol to that used for the Meg line.…”

Section: A Similar Repertoire Restriction At the E To F Transition Inmentioning

confidence: 99%

A B-cell receptor-specific selection step governs immature to mature B cell differentiation

Levine

Haberman

Sant’Angelo

et al. 2000

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

143

115

View full text Add to dashboard Cite

(3,4). Before these immature cells leave the bone marrow for the periphery, it has been shown, they undergo several types of negative selection to avoid autoreactivity. These processes, including clonal deletion (5), receptor editing (6, 7), and clonal anergy (8), are thought to be largely complete before the exit of these cells into the periphery, where a fraction of them subsequently differentiate into mature B cells (Hardy fraction F) (9, 10), which are surface IgM int , IgD hi , B220 hi , HSA int (4). Seventy percent of peripheral immature B cells that bear functional surface IgM (fraction E) do not survive to maturity (fraction F), although the nature of the process that causes this cell loss is unknown (3). This cell loss either could occur by a stochastic process in which cell fate is determined without regard to the specificity of the BCR or could occur by a selective process in which the specificity of the BCR determines which cells can survive.To better understand the selective processes that determine which immature B cells survive to comprise the mature BCR repertoire, we examined the BCR repertoire of immature peripheral B cells and compared it to the BCR repertoire of mature peripheral B cells. A stochastic process would predict identical BCR repertoires in the immature and mature B cell populations; a selective process would be reflected by substantial differences between the two repertoires. We find that there is indeed significant selection of the BCR repertoire at the immature to mature conventional B cell transition in the periphery of the mouse. The nature of this selection is most indicative of positive selection of certain cells that comprise a small fraction of the BCR repertoire. Materials and MethodsMice. Heavy chain transgenic mice of Meg and Daisy line were constructed as described (11) -biotin antibody (PharMingen). All biotinylated antibodies were revealed with streptavidin-Texas Red. Additional staining with anti-B7.2-biotin (clone GL1) (12), rat anti-mouse-CD1d purified antibody (PharMingen) followed by a goat anti-rat-IgG-biotin secondary (Kirkegaard & Perry Laboratories), anti-CD5 (clone 53.7), and anti-CD44 (clone PgP-1) (11) was performed to assess surface expression of these markers. PCR Amplification. Genomic DNA was extracted with the DNAzol reagent (GIBCO͞BRL) and was amplified by using a degenerate V consensus primer (13) and one of two J 2 intronic primers. The internal J 2 primer (14) was utilized for the first Meg line mouse and all three Daisy line mice analyzed. An external J 2 primer, TCCCTCCTTAACACCTGATCTGAGAATGG, was used for the analysis of the second two Meg line mice and the wild-type control mouse. PCR conditions were 28 cycles of 94°C for 30 sec, 60°C for 90 sec, and 72°C for 60 sec, with a 5-sec extension per cycle (14).Cloning and Sequencing. Consensus V -J 2 PCR products (Ϸ190 bp for the internal J 2 primer and Ϸ300 bp for the external J 2 Abbreviation: BCR, B cell receptor.

show abstract

A rheumatoid factor transgenic mouse model of autoantibody regulation

Cited by 126 publications

References 0 publications

Natural Autoreactive B Cells in Transgenic Mice Reproduce an Apparent Paradox to the Clonal Tolerance Theory

Natural Autoreactive B Cells in Transgenic Mice Reproduce an Apparent Paradox to the Clonal Tolerance Theory

BLyS inhibition eliminates primary B cells but leaves natural and acquired humoral immunity intact

A B-cell receptor-specific selection step governs immature to mature B cell differentiation

Contact Info

Product

Resources

About