A specific role for <i><scp>PRND</scp></i> in goat foetal Leydig cells is suggested by prion family gene expression during gonad development in goats and mice

Allais‐Bonnet, Aurélie; Castille, Johan; Pannetier, Maëlle; Passet, Bruno; Elzaïat, Maëva; André, Marjolaine; Montazer-Torbati, Fatemeh; Moazami‐Goudarzi, Katayoun; Vilotte, Jean–Luc; Pailhoux, Eric

doi:10.1002/2211-5463.12002

Cited by 3 publications

(3 citation statements)

References 43 publications

(64 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…PrP C has been detected in the Sertoli cells of immature goat bucks (130 days post conception) and in ejaculated buck spermatozoa (Allais-Bonnet et al, 2016 ). Levels of PRNP mRNA were high in buck testicular tissue from birth and gradually decreased to reach a steady level at puberty.…”

Section: Discussionmentioning

confidence: 99%

Stress Resilience of Spermatozoa and Blood Mononuclear Cells without Prion Protein

Reiten

Malachin

Kommisrud

et al. 2018

Front. Mol. Biosci.

View full text Add to dashboard Cite

The cellular prion protein PrPC is highly expressed in neurons, but also present in non-neuronal tissues, including the testicles and spermatozoa. Most immune cells and their bone marrow precursors also express PrPC. Clearly, this protein operates in highly diverse cellular contexts. Investigations into putative stress-protective roles for PrPC have resulted in an array of functions, such as inhibition of apoptosis, stimulation of anti-oxidant enzymes, scavenging roles, and a role in nuclear DNA repair. We have studied stress resilience of spermatozoa and peripheral blood mononuclear cells (PBMCs) derived from non-transgenic goats that lack PrPC (PRNPTer/Ter) compared with cells from normal (PRNP+/+) goats. Spermatozoa were analyzed for freeze tolerance, DNA integrity, viability, motility, ATP levels, and acrosome intactness at rest and after acute stress, induced by Cu2+ ions, as well as levels of reactive oxygen species (ROS) after exposure to FeSO4 and H2O2. Surprisingly, PrPC-negative spermatozoa reacted similarly to normal spermatozoa in all read-outs. Moreover, in vitro exposure of PBMCs to Doxorubicin, H2O2 and methyl methanesulfonate (MMS), revealed no effect of PrPC on cellular survival or global accumulation of DNA damage. Similar results were obtained with human neuroblastoma (SH-SY5Y) cell lines stably expressing varying levels of PrPC. RNA sequencing of PBMCs (n = 8 of PRNP+/+ and PRNPTer/Ter) showed that basal level expression of genes encoding DNA repair enzymes, ROS scavenging, and antioxidant enzymes were unaffected by the absence of PrPC. Data presented here questions the in vitro cytoprotective roles previously attributed to PrPC, although not excluding such functions in other cell types or tissues during inflammatory stress.

show abstract

Section: Discussionmentioning

confidence: 99%

Stress Resilience of Spermatozoa and Blood Mononuclear Cells without Prion Protein

Reiten

Malachin

Kommisrud

et al. 2018

Front. Mol. Biosci.

View full text Add to dashboard Cite

show abstract

“…1 Meanwhile, several polymorphisms of PRND gene had been shown to influence the goat early sex differentiation 2 as well as ram fertility, 3 especially affecting the differentiation of goat foetal leydig cells. 4 Remarkably, at present, there is no study that reveals the relationship of the insertion/deletion (indel) polymorphisms of PRND gene with scrapie susceptibility or growth traits in sheep.…”

Section: Introductionmentioning

confidence: 99%

“…5 Previous study also has demonstrated the feasibility and high efficiency of the ME method in low-frequency detection. 5 To detect the possible indel of sheep PRND gene by using ME method, a total of 623 sheep from the 4…”

Section: Introductionmentioning

confidence: 99%

Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method

Zhu

et al. 2017

Prion

View full text Add to dashboard Cite

Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.

show abstract

Phthalate plasticizer decreases the prion-like protein doppel essential for structural integrity and function of spermatozoa

Lee

Park

Ryou

et al. 2022

Ecotoxicology and Environmental Safety

View full text Add to dashboard Cite

A specific role for PRND in goat foetal Leydig cells is suggested by prion family gene expression during gonad development in goats and mice

Cited by 3 publications

References 43 publications

Stress Resilience of Spermatozoa and Blood Mononuclear Cells without Prion Protein

Stress Resilience of Spermatozoa and Blood Mononuclear Cells without Prion Protein

Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method

Phthalate plasticizer decreases the prion-like protein doppel essential for structural integrity and function of spermatozoa

Contact Info

Product

Resources

About