A system for the propagation of adenoviral vectors with genetically modified receptor specificities

Douglas, Joanne T.; Miller, C. Ryan; Kim, Myung‐Hee; Dmitriev, Igor; Mikheeva, Galina; Krasnykh, Victor; Curiel, David T.

doi:10.1038/8647

Cited by 130 publications

(114 citation statements)

References 33 publications

Supporting

Mentioning

113

Contrasting

Unclassified

Order By: Relevance

“…293.HissFv.rec cells express an artificial receptor against six histidine (His) residues, containing an anti-His single chain antibody (sFv). 29 The 293-38 is a high-efficiency virus-producing clone of 293 cells, and the 293-38 cells expressing an anti-His sFv stably (293-38.HissFv.rec) were generated by retrovirusmediated transduction. 15 Shuttle plasmids and recombinant adenovirus DNA…”

Section: Cell Linesmentioning

confidence: 99%

“…29 The plasmid has two incompatible restriction enzyme sites in the HI-loop to display random peptides and includes 4-point mutations in the AB-loop of the fiber knob to abolish CAR binding, and six histidine residues were incorporated into the carboxy terminal of the fiber knob, so that the vector can be propagated in the 293 cells expressing an anti-His sFv. The pBHIDCAR-SYE and pBHIDCAR-IVR plasmids have TCGTATGAGAATTTTAGTGCG (SYENFSA) and ATTGTTCGTGGTCGGGTGTTT (IVRGRVF) sequences in the HI-loop of the shuttle plasmid, respectively.…”

Section: Cell Linesmentioning

confidence: 99%

See 1 more Smart Citation

Oncolytic virus therapy for pancreatic cancer using the adenovirus library displaying random peptides on the fiber knob

Nishimoto

Yoshida²,

Miura³

et al. 2009

Gene Ther

View full text Add to dashboard Cite

A conditionally replicative adenovirus is a novel anticancer agent designed to replicate selectively in tumor cells. However, a leak of the virus into systemic circulation from the tumors often causes ectopic infection of various organs. Therefore, suppression of naive viral tropism and addition of tumor-targeting potential are necessary to secure patient safety and increase the therapeutic effect of an oncolytic adenovirus in the clinical setting. We have recently developed a direct selection method of targeted vector from a random peptide library displayed on an adenoviral fiber knob to overcome the limitation that many cell type-specific ligands for targeted adenovirus vectors are not known. Here we examined whether the addition of a tumor-targeting ligand to a replication-competent adenovirus ablated for naive tropism enhances its therapeutic index. First, a peptide-display adenovirus library was screened on a pancreatic cancer cell line (AsPC-1), and particular peptide sequences were selected. The replication-competent adenovirus displaying the selected ligand (AdDCAR-SYE) showed higher oncolytic potency in several other pancreatic caner cell lines as well as AsPC-1 compared with the untargeted adenovirus (AdDCAR). An intratumoral injection of AdDCAR-SYE significantly suppressed the growth of AsPC-1 subcutaneous tumors, and an analysis of adenovirus titer in the tumors revealed an effective replication of the virus in the tumors. Ectopic liver gene transduction following the intratumoral injection of AdDCAR-SYE was not increased compared with the AdDCAR. The results showed that a tumor-targeting strategy using an adenovirus library is promising for optimizing the safety and efficacy of oncolytic adenovirus therapy.

show abstract

Section: Cell Linesmentioning

confidence: 99%

Section: Cell Linesmentioning

confidence: 99%

Oncolytic virus therapy for pancreatic cancer using the adenovirus library displaying random peptides on the fiber knob

Nishimoto

Yoshida²,

Miura³

et al. 2009

Gene Ther

View full text Add to dashboard Cite

show abstract

“…14 (ii) Generation of the vector expressing the Ad5 fiber with the RGD motif in the HI loop. This plasmid was designed using the previously made fiber-RGD gene assembled within the fiber shuttle vector pNEB.PK.F HI -RGD.…”

Section: Construction Of the Modified Fiber Genesmentioning

confidence: 99%

Complex mosaicism is a novel approach to infectivity enhancement of adenovirus type 5-based vectors

et al. 2005

View full text Add to dashboard Cite

The use of adenovirus type 5 (Ad5) for cancer therapy is limited by deficiency of its primary cell attachment receptor, coxsackie and adenovirus receptor (CAR), on cancer cells. Ad5 retargeting to alternate receptors through fiber genetic modification can be used to circumvent CAR dependence of its tropism, and thereby achieve infectivity enhancement. Here we propose and test a novel ''complex mosaicism'' approach for fiber modification, which combines serotype chimerism with peptide ligand(s) incorporation in a single-fiber molecule. We incorporated integrin-binding peptide RGD-4C in the HI-loop, at the carboxy (C)-terminus, or both locales of the Ad3 knob, in the context of Ad5/3 chimera fiber in order to retarget simultaneously the Ad vector to integrins and Ad3 receptors. The infectivity enhancement of the fiber modifications was assessed in various cancer cell lines as cancer-targeting models. Replication-defective complex mosaic Ad-luc vectors bearing chimeric fiber (F.5/3), with or without C-terminal RGDmodification of Ad3 knob, demonstrated up to 55-fold gene transfer increase in bladder cancer cell lines. Although this augmentation was primarily due to Ad3 receptor targeting, some contribution of RGD-mediated integrin-targeting was also observed, suggesting that complex mosaic modification can function in a dual-receptor targeting via a single Ad3 fiber knob.

show abstract

“…This has been accomplished by constructing cell lines which express alternate 'pseudoreceptor' targeted adenovirus vectors. 17,18 These pseudoreceptors act as surrogate receptors which mediate the binding and uptake of targeted vectors in the absence of CAR binding. These pseudoreceptors have been comprised of a receptor transmembrane domain fused to a single-chain antibody which directly recognize one of the coat proteins or recognize a linear peptide epitope genetically incorporated into a coat protein.…”

Section: One-component Targetingmentioning

confidence: 99%

Targeting adenovirus

2000

View full text Add to dashboard Cite

A system for the propagation of adenoviral vectors with genetically modified receptor specificities

Cited by 130 publications

References 33 publications

Oncolytic virus therapy for pancreatic cancer using the adenovirus library displaying random peptides on the fiber knob

Oncolytic virus therapy for pancreatic cancer using the adenovirus library displaying random peptides on the fiber knob

Complex mosaicism is a novel approach to infectivity enhancement of adenovirus type 5-based vectors

Targeting adenovirus

Contact Info

Product

Resources

About