Abnormal Hedgehog pathway in myelodysplastic syndrome and its impact on patients' outcome

Xavier-Ferrucio, Juliana M.; Pericole, Fernando V; Lopes, Matheus Rodrigues; Latuf-Filho, Paulo; Barcellos, Karin Spät Albino; Dias, Amanda Inácio; Campos, Paula de Melo; Traina, Fabı́ola; Vassallo, José; Saad, Sara Teresinha Olalla; Favaro, Patrícia

doi:10.3324/haematol.2015.124040

Cited by 11 publications

(10 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…RNA was purified with Illustra RNAspin Mini Kit (GE Healthcare Life Sciences, UK) and reverse transcribed with RevertAid H minus First Strand cDNA synthesis Kit (ThermoScientific, Inc., USA). Real time quantitative PCR was carried out as previously described ( Xavier-Ferrucio et al, 2015 ), in an Eppendorf MasterCycler using SYBR green master mix (ThermoScientific, Inc., USA). Gene expression was determined, using specific primers: murine Arhgap21 (NM_001128084) Arhgap21 forward: GAGGAAAGCTTCAAGCACCA, Arhgap21 reverse: GATGACAGC AGATCAGGAA; Hprt forward: GGGGGCTATAAGTTCTTTGCT and HPRT reverse: GGCCTGTATCCAACACTTCG; human ARHGAP21 (NM_020824) ARHGAP21 forward: CAATGGATACCATATTTGTTAAGCAAGTT, ARHGAP21 reverse: CACTTTCTCCATTGACTTTTATAATTCG, HPRT forward: TTGCTTTCCTTGGTCAGGCA and HPRT reverse: TTCGTGGGGTC CTTTTCACC.…”

Section: Methodsmentioning

confidence: 99%

Hematopoietic defects in response to reduced Arhgap21

et al. 2018

View full text Add to dashboard Cite

Arhgap21 is a member of the Rho GTPase activating protein (RhoGAP) family, which function as negative regulators of Rho GTPases. Arhgap21 has been implicated in adhesion and migration of cancer cells. However, the role of Arhgap21 has never been investigated in hematopoietic cells. Herein, we evaluated functional aspects of hematopoietic stem and progenitor cells (HSPC) using a haploinsufficient (Arhgap21+/−) mouse. Our results show that Arhgap21+/− mice have an increased frequency of phenotypic HSC, impaired ability to form progenitor colonies in vitro and decreased hematopoietic engraftment in vivo, along with a decrease in LSK cell frequency during serial bone marrow transplantation. Arhgap21+/− hematopoietic progenitor cells have impaired adhesion and enhanced mobilization of immature LSK and myeloid progenitors. Arhgap21+/− mice also exhibit reduced erythroid commitment and differentiation, which was recapitulated in human primary cells, in which knockdown of ARHGAP21 in CMP and MEP resulted in decreased erythroid commitment. Finally, we observed enhanced RhoC activity in the bone marrow cells of Arhgap21+/− mice, indicating that Arhgap21 functions in hematopoiesis may be at least partially mediated by RhoC inactivation.

show abstract

Section: Methodsmentioning

confidence: 99%

Hematopoietic defects in response to reduced Arhgap21

et al. 2018

View full text Add to dashboard Cite

show abstract

“…Most recently we established that GLI2 expression is an independent predictor of poor outcome in FLT3-ITD -mutated AML, and Hh activation leads to accelerated progression and leukemic transformation of FLT3 -ITD-driven indolent myeloproliferative disease in mice [18]. Only limited data exist on Hh signaling in MDS and very little is known about the role of pathway activation in disease development and progression [22]. Hh inhibitors have been shown to be effective in preclinical studies in MDS and AML, and preliminary data from ongoing clinical trials using SMO inhibitors demonstrate promising antitumor activity [23, 24].…”

Section: Introductionmentioning

confidence: 99%

Hedgehog/GLI1 activation leads to leukemic transformation of myelodysplastic syndrome in vivo and GLI1 inhibition results in antitumor activity

et al. 2018

View full text Add to dashboard Cite

Myelodysplastic syndromes (MDSs) are stem cell disorders with risk of transformation to acute myeloid leukemia (AML). Gene expression profiling reveals transcriptional expression of GLI1, of Hedgehog (Hh) signaling, in poor-risk MDS/AML. Using a murine model of MDS we demonstrated that constitutive Hh/Gli1 activation accelerated leukemic transformation and decreased overall survival. Hh/Gli1 activation resulted in clonal expansion of phenotypically defined granulocyte macrophage progenitors (GMPs) and acquisition of self-renewal potential in a non-self-renewing progenitor compartment. Transcriptome analysis of GMPs revealed enrichment in gene signatures of self-renewal pathways, operating via direct Gli1 activation. Using human cell lines we demonstrated that in addition to canonical Hh signaling, GLI1 is activated in a Smoothened-independent manner. GLI1 knockdown or inhibition with GANT61 resulted in decreased proliferation and clonogenic potential. Our data suggest that GLI1 activation is frequent in MDS during disease progression and inhibition of GLI1 is an attractive therapeutic target for a subset of patients.

show abstract

“…The HH pathway is important to normal hematopoiesis and is both lineage and stage dependent and disruption of the HH pathway has been found in many hematologic malignancies, with a strong relation to MDS and progression into AML. 57 , 167 , 168 Studies have found that myeloid malignancies express higher levels of HH proteins and their downstream targets with the majority of AML patient samples overexpressing SHH, PTCH-1, SMO, and/or GLI family proteins. 169 Importantly, GLI1 expression has been found to be elevated in the blasts of relapsed AML patients.…”

Section: Targeting Signaling Pathways In Amlmentioning

confidence: 99%

Targeting multiple signaling pathways: the new approach to acute myeloid leukemia therapy

Carter

Hege

Yang

et al. 2020

Sig Transduct Target Ther

139

View full text Add to dashboard Cite

Acute myeloid leukemia (AML) is the most common form of acute leukemia in adults and the second most common form of acute leukemia in children. Despite this, very little improvement in survival rates has been achieved over the past few decades. This is partially due to the heterogeneity of AML and the need for more targeted therapeutics than the traditional cytotoxic chemotherapies that have been a mainstay in therapy for the past 50 years. In the past 20 years, research has been diversifying the approach to treating AML by investigating molecular pathways uniquely relevant to AML cell proliferation and survival. Here we review the development of novel therapeutics in targeting apoptosis, receptor tyrosine kinase (RTK) signaling, hedgehog (HH) pathway, mitochondrial function, DNA repair, and c-Myc signaling. There has been an impressive effort into better understanding the diversity of AML cell characteristics and here we highlight important preclinical studies that have supported therapeutic development and continue to promote new ways to target AML cells. In addition, we describe clinical investigations that have led to FDA approval of new targeted AML therapies and ongoing clinical trials of novel therapies targeting AML survival pathways. We also describe the complexity of targeting leukemia stem cells (LSCs) as an approach to addressing relapse and remission in AML and targetable pathways that are unique to LSC survival. This comprehensive review details what we currently understand about the signaling pathways that support AML cell survival and the exceptional ways in which we disrupt them.

show abstract

Abnormal Hedgehog pathway in myelodysplastic syndrome and its impact on patients' outcome

Cited by 11 publications

References 17 publications

Hematopoietic defects in response to reduced Arhgap21

Hematopoietic defects in response to reduced Arhgap21

Hedgehog/GLI1 activation leads to leukemic transformation of myelodysplastic syndrome in vivo and GLI1 inhibition results in antitumor activity

Targeting multiple signaling pathways: the new approach to acute myeloid leukemia therapy

Contact Info

Product

Resources

About