Acute Intermittent Porphyria

Chen

BioMed Research International

et al. 2016

Porphyria is a group of eight metabolic disorders characterized by defects in heme biosynthesis. The presentation of porphyria is highly variable, and the symptoms are nonspecific, which accounts in part for delays in establishing a diagnosis. In this study, we report the characteristics of 36 Chinese acute porphyria patients. Most of them were female (33/36), and the median age was 25.3 years (range 18–45 years). The most frequent presenting symptom was abdominal pain (32/36). Hyponatremia was the most common electrolyte abnormality (29/36), and the serum sodium concentration was significantly negatively correlated with convulsion (p = 0.00). Genetic testing provided a precise diagnosis of the patients. Genetic analysis of the porphobilinogen deaminase (PBGD) gene was performed for 10 subjects. Of them, 9 were found to harbor a mutation in the PBGD gene, proving a diagnosis of acute intermittent porphyria, and, in 1 case, a novel Cys209Term mutation was found.

“…Four patients from 4 families had the same mutation (Arg173Trp). Two had been previously reported [5, 11]. Of the mutations identified, Cys209Term is a novel PBGD mutation.…”

Section: Resultsmentioning

confidence: 99%

Clinical and Laboratory Features of Acute Porphyria: A Study of 36 Subjects in a Chinese Tertiary Referral Center

Chen

BioMed Research International

et al. 2016

“…AIP should be remembered as an important differential diagnosis for neuromuscular disorders (de Souza et al, 2021). In our study, hyponatremia is the most common biochemical abnormality, 55.5% of patients had hyponatremia which may be associated with syndrome of inappropriate antidiuretic hormone secretion (SIADH) (Li et al, 2015;Yang et al, 2016). It has been shown that large accumulations of porphyrin precursors cause damage to the hypothalamus, resulting in increased secretion of vasopressin and retention of large amounts of body fluid, causing dilutional hyponatremia (Aksoy Ö et al, 2020).…”

Section: Discussionmentioning

confidence: 74%

“…The full text of the remaining 209 studies was downloaded and evaluated, and another 168 studies were further excluded due to no variants reported or variants of the same family reported. Finally, 41 studies ( Lam et al, 2001 ; Yang et al, 2008 ; Lam et al, 2011 ; Xie, 2012 ; Kong et al, 2013 ; Zhou, 2014 ; Li et al, 2015 ; Li et al, 2015 ; Chen et al, 2015 ; Jiao et al, 2015 ; Yang et al, 2015 ; You et al, 2015 ; Yuan et al, 2015 ; Li et al, 2016 ; Yang et al, 2016 ; Lei et al, 2017 ; Li et al, 2017 ; Yang et al, 2017 ; Hu et al, 2018a ; Zheng et al, 2018 ; Wang et al, 2019 ; Wang et al, 2019 ; Hu, 2019 ; Zhang and Gao, 2019 ; Yang et al, 2020 ; Yang et al, 2020 ; Zhang et al, 2020 ; Sun et al, 2020 ; Teng et al, 2020 ; Fu et al, 2021 ; Gao et al, 2021 ; Huang et al, 2021 ; Zhang et al, 2021 ; Haiqing, 2022 ; Hu et al, 2022 ; Li, 2022 ; Li et al, 2022 ; Yang et al, 2022 ; Zhou et al, 2022 ; Guo and Luo, 2023 ; Liang and Li, 2023 ) were obtained for analysis (21 English-language and 20 Chinese-language articles).…”

Section: Resultsmentioning

confidence: 99%

Clinical feature and genetic analysis of HMBS gene in Chinese patients with acute intermittent porphyria: a systematic review

Ren,

Li,

Lei

et al. 2023

Front. Genet.

Background: Early detection and diagnosis are important crucial to prevent life-threatening acute attacks in patients with acute intermittent porphyria (AIP). We aim to provide comprehensive data on the clinical and hydroxymethylbilane synthase (HMBS) gene variant characteristics and genotype-phenotype association of Chinese patients with AIP in order to improve clinicians’ knowledge of AIP and reduce misdiagnosis and mistaken treatment.Methods: We searched the literature on Chinese patients with AIP in PubMed, Web of Science, Wiley Online Library, ScienceDirect and Chinese literature databases up to August 2023 in our analysis to explore the clinical and HMBS gene variant characteristics of Chinese patients with AIP.Results: A total of 41 original articles associated with Chinese AIP patients were included for analysis: 97 variants were detected in 160 unrelated families, including 35 missense, 29 frameshift, 24 splicing and 9 nonsense variants, with c.517C>T being the most common variant. Clinical data were reported in 77 of 160 patients: Most of them were female (67/77) and the age was 28.8 ± 9.9 years. The most common symptom was abdominal pain (73/77, 94.8%), followed by central nervous system symptoms (45/77, 58.4%). 13.0% (10/77) of patients experienced psychiatric symptoms. Hyponatremia was the most common electrolyte abnormality (42/77). 31 patients received carbohydrate loading therapy, and 30 of them were improved. 6 patients were treated with carbohydrate loading combined with hemin therapy and 5 eventually improved. All variants causing premature stop codons, frameshifts or enzyme activity center may experience more severe clinical phenotypes such as seizures, respiratory paralysis, intracranial hemorrhage disorder or respiratory failure.Conclusion: The most common presenting symptom in Chinese AIP patients was abdominal pain, followed by central nervous system symptoms. The HMBS gene analysis in Chinese AIP patients revealed that the heterogeneity is strong and the most common variant was missense mutation, with c.517C>T being the most common variant. The genotype-phenotype association helps guide clinical diagnosis and treatment. However, the treatment for AIP in China is limited and monolithic, and more attention needs to be paid to the treatment.

“…C.806 C>G (p. T269R), IVS11–2A→G, p.R173Q, c.973C>T (p.R325X), and c.1071delT mutations were identified in the Chinese population. [ 6 , 17 – 19 ] IVS2–2AgG, c.655G>C (p.A219P), and c.988G>C (p.Ala330Pro) mutations were newly found. [ 18 , 20 , 21 ] At the same time, these scattered reports reveal the fact that the biochemistry or gene testing on AIP cannot be universal yet in China, in accordance with the phenomena that most Chinese doctors may not be familiar with varied clinical manifestations of AIP.…”

Section: Discussionmentioning

confidence: 99%

“…It is crucial for physicians to make a timely diagnosis to prevent life-threatening progression of AIP. However, diagnosis of AIP is still a huge challenge in many countries, [ 2 – 6 ] mainly due to variable clinical manifestations and/or low penetrance. Clinical diagnosis of AIP is mostly based on raised levels of PBG in urine and serum.…”

Section: Introductionmentioning

confidence: 99%

A novel 55-basepair deletion of hydroxymethylbilane synthase gene found in a Chinese patient with acute intermittent porphyria and her family

Ren

Liu

et al. 2018

Medicine

Rationale:Acute intermittent porphyria (AIP) is caused by hydroxymethylbilane synthase (HMBS) gene mutation.Patient concerns:A Chinese female patient with very typical AIP symptoms of severe abdominal pain, seizures, hypertension, and tachycardia, accompanied with hyponatremia, anemia, and hyperbilirubinemia.Diagnoses:She was diagnosed as AIP based on positive result of urine porphobilinogen and her clinical syndrome.Interventions:The proband was treated with intravenous glucose (at least 250 g per day) for 4 days. HMBS mutation was investigated in this family by Sanger sequencing.Outcomes:A heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. The mutation has not been documented in current gene databases. Further prediction of mutated protein structure suggests that the mutation is likely to produce prolonged peptide with structural change and less stability.Lessons:Physicians should pay attention to AIP attack in patients with suspected symptoms and make use of genetic testing to increase identification of mutated HMBS gene carriers for further preventive strategy.