Adapting CRISPR/Cas9 for Functional Genomics Screens

Malina, Abba; Katigbak, Alexandra; Cencic, Regina; Maïga, Rayelle Itoua; Robert, Françis; Miura, Hisashi

doi:10.1016/b978-0-12-801185-0.00010-6

Cited by 19 publications

(18 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We designed two gRNAs against exon 1 of the PPARGC1A gene and validated three clones for loss of PGC1α expression. sgRNA sequence #1 (GGCGTGGGACATGTGCAACC) and #2 (ACCAGGACTCTGAGTCTGTA) were then inserted by linker cloning in the lentiviral vector pLCiG2 53,54 . HA expressing the empty vector or F3-T3 were infected either with pLCiG2/Control, pLCiG2/ PPARGC1A -gRNA #1 or pLCiG2/ PPARGC1A -gRNA #2.…”

Section: Methodsmentioning

confidence: 99%

A metabolic function of FGFR3-TACC3 gene fusions in cancer

Frattini

Pagnotta

Tala

et al. 2018

Nature

167

163

View full text Add to dashboard Cite

Chromosomal translocations that generate in-frame oncogenic gene fusions are powerful examples of success of targeted cancer therapies1–3. We discovered FGFR3-TACC3 (F3-T3) gene fusions in 3% of human glioblastoma4. Subsequent studies reported similar frequencies of F3-T3 in many other cancers, thus qualifying F3-T3 as one of the most recurrent fusions across all tumor types5,6. F3-T3 fusions are potent oncogenes that confer sensitivity to FGFR inhibitors but the downstream oncogenic signaling remains largely unknown2,4–6. Here, we report that tumors harboring F3-T3 cluster within transcriptional subgroups characterized by activation of mitochondrial functions. F3-T3 activates oxidative phosphorylation and mitochondrial biogenesis and induces sensitivity to inhibitors of oxidative metabolism. We show that phosphorylation of PIN4 is the signaling intermediate for the activation of mitochondrial metabolism. The F3-T3-PIN4 axis triggers peroxisome biogenesis and new protein synthesis. The anabolic response converges on PGC1α through intracellular ROS, enabling mitochondrial respiration and tumor growth. Our analyses uncover the oncogenic circuit engaged by F3-T3, expose reliance on mitochondrial respiration as unexpected therapeutic opportunity for F3-T3-positive tumors and provide a clue to the genetic alterations that initiate the chain of metabolic responses driving mitochondrial metabolism in cancer.

show abstract

Section: Methodsmentioning

confidence: 99%

A metabolic function of FGFR3-TACC3 gene fusions in cancer

Frattini

Pagnotta

Tala

et al. 2018

Nature

167

163

View full text Add to dashboard Cite

show abstract

“…All sgRNAs were co-expressed with Cas9 from a second generation “All-in-One” retroviral vector that also produced green fluorescent protein (GFP), enabling tracking of infected cells by flow cytometry (Fig. 1a)18.…”

Section: Resultsmentioning

confidence: 99%

A CRISPR/Cas9 Functional Screen Identifies Rare Tumor Suppressors

Katigbak

Cencic

Robert

et al. 2016

Sci Rep

Self Cite

View full text Add to dashboard Cite

An enormous amount of tumor sequencing data has been generated through large scale sequencing efforts. The functional consequences of the majority of mutations identified by such projects remain an open, unexplored question. This problem is particularly complicated in the case of rare mutations where frequency of occurrence alone or prediction of functional consequences are insufficient to distinguish driver from passenger or bystander mutations. We combine genome editing technology with a powerful mouse cancer model to uncover previously unsuspected rare oncogenic mutations in Burkitt’s lymphoma. We identify two candidate tumor suppressors whose loss cooperate with MYC over-expression to accelerate lymphomagenesis. Our results highlight the utility of in vivo CRISPR/Cas9 screens combined with powerful mouse models to identify and validate rare oncogenic modifier events from tumor mutational data.

show abstract

“…Genomic loci positioned mega bases away on same or different chromosomes could be brought closer given apt chromosomal organization, consequently mediating lengthy trans interactions (Ma et al, 2014). Conversely, there is still question mark upon manner for genome modification and in vivo modulation of their structural organization afterward (Malina et al, 2014). But, without vital methodology for DNA visualization, studying various gene interactions in different chromatin states would merely be a dream.…”

Section: Applications Of Crispr-cas9 In Plant Biology and Biotechnologymentioning

confidence: 99%

CRISPR-Cas9: Tool for Qualitative and Quantitative Plant Genome Editing

Noman

Aqeel

2016

Front. Plant Sci.

View full text Add to dashboard Cite

Recent developments in genome editing techniques have aroused substantial excitement among agricultural scientists. These techniques offer new opportunities for developing improved plant lines with addition of important traits or removal of undesirable traits. Increased adoption of genome editing has been geared by swiftly developing Clustered regularly interspaced short palindromic repeats (CRISPR). This is appearing as driving force for innovative utilization in diverse branches of plant biology. CRISPR-Cas9 mediated genome editing is being used for rapid, easy and efficient alteration of genes among diverse plant species. With approximate completion of conceptual work about CRISPR-Cas9, plant scientists are applying this genome editing tool for crop attributes enhancement. The capability of this system for performing targeted and efficient modifications in genome sequence as well as gene expression will certainly spur novel developments not only in model plants but in crop and ornamental plants as well. Additionally, due to non-involvement of foreign DNA, this technique may help alleviating regulatory issues associated with genetically modified plants. We expect that prevailing challenges in plant science like genomic region manipulation, crop specific vectors etc. will be addressed along with sustained growth of this genome editing tool. In this review, recent progress of CRISPR-Cas9 technology in plants has been summarized and discussed. We reviewed significance of CRISPR-Cas9 for specific and non-traditional aspects of plant life. It also covers strengths of this technique in comparison with other genome editing techniques, e.g., Zinc finger nucleases, Transcription activator-like effector nucleases and potential challenges in coming decades have been described.

show abstract

Adapting CRISPR/Cas9 for Functional Genomics Screens

Cited by 19 publications

References 29 publications

A metabolic function of FGFR3-TACC3 gene fusions in cancer

A metabolic function of FGFR3-TACC3 gene fusions in cancer

A CRISPR/Cas9 Functional Screen Identifies Rare Tumor Suppressors

CRISPR-Cas9: Tool for Qualitative and Quantitative Plant Genome Editing

Contact Info

Product

Resources

About