Adenovirus detection in shellfish and urban sewage in Morocco (Casablanca region) by the polymerase chain reaction

Karamoko, Y.; Ibenyassine, K.; AitMhand, R.; Idaomar, M.; Ennaji, Moulay Mustapha

doi:10.1016/j.jviromet.2005.02.003

Cited by 23 publications

(23 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Some studies have revealed the presence of hepatitis A virus (Karamoko et al, 2006a), adenovirus (Karamoko et al, 2005) and enteroviruses (Karamoko et al, 2006b) respectively in 37.5, 15 and10% of mussel samples in the costal media. Other studies Sabin 3 VDPV 3D Sense CACCAAAGAAATGCAAAGACTTT Anti-sense GGATCGCATCCAACTGCACT 3D probe ROX-CCTACCATTAGTGACATATGT-BHQ2 Figure 5.…”

Section: Resultsmentioning

confidence: 99%

Detection of enterovirus in mussels from Morocco by cell culture and real-time PCR

Azzouzi¹,

Senouci²,

Qazoui³

et al. 2017

Afr. J. Biotechnol.

View full text Add to dashboard Cite

The bivalve shellfish are filter feeders and they act as natural bio-filters in seawater and can thus efficiently bio-concentrate and bio-accumulate enteric viruses in their digestive tissue. In Morocco, shellfish sanitary quality analysis does not currently include enteric virus detection. Therefore, the objective of this study was to detect the presence of enterovirus in mussels (Mytilus galloprovincialis) collected from three wild populations (Bouregreg estuary, Yacoub Al Mansour coast and Harhoura coast) in order to get an overview on the viral contamination in the aquatic environment. Between February 2014 and February 2015, two hundred and eighty-eight samples were collected and tested for viral contamination using cell culture and real-time polymerase chain reaction (real-time PCR) for intratypic differentiation (ITD). The results by cell culture and real-time PCR showed that the consumption of mussels originated from a contaminated area revealed a clear risk of infection. For this reason, the presence of enterovirus in shellfish production area represents a potential health risk by causing serious illnesses (gastroenteritis, hepatitis and poliomyelitis).

show abstract

Section: Resultsmentioning

confidence: 99%

Detection of enterovirus in mussels from Morocco by cell culture and real-time PCR

Azzouzi¹,

Senouci²,

Qazoui³

et al. 2017

Afr. J. Biotechnol.

View full text Add to dashboard Cite

show abstract

“…Our results suggest that the method was not suitable for molecular detection if the retail oyster samples were not subjected to enrichment (Table 2). It has been reported that only 6.1% of the samples were positive for V. parahaemolyticus without enrichment [24]. In the absence of any treatment, PCR inhibitors may be present in the oyster, which interfere with PCR amplification [19,35].…”

Section: Resultsmentioning

confidence: 99%

“…The oyster is very different from common agricultural produce due to its bio-accumulating nature. The densities of V. parahaemolyticus in oysters were > 10-10 4 CFU/g in oysters [24]. Over 107 CFU of aerobic bacteria per gram were found in retail oysters after 1 week storage at 4°C [31].…”

Section: Introductionmentioning

confidence: 93%

“…Efficient amounts of sample DNA of high quality is of critical importance for molecular assays. So far, different methods have been used to extract the DNA samples, including commercial kits [19,21,22], the phenol-chloroform method [15,23] and the boiling lysis method [10,24,25].…”

Section: Introductionmentioning

confidence: 99%

“…It was reported that V. parahaemolyticus could be detected without enrichment, but no further data were reported [20,24]. Generally, seafood samples are subjected to enrichment overnight to allow growth of pathogenic bacteria [19,[28][29][30] prior to detection assays.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

http://www.omicsonline.org/open-access/overcoming-pseudomonas-aeruginosa-resistance-caused-by-glycocalyx-with-tobracef-1948-5948.1000145.php?aid=25925

Dai¹

2014

J Microb Biochem Technol

View full text Add to dashboard Cite

Oysters are filter feeders that bioaccumulate bacteria in water while feeding. To evaluate the bacterial genomic DNA extracted from retail oyster tissues, including the gills and digestive glands, four isolation methods were used. Genomic DNA extraction was performed using the Allmag™ Blood Genomic DNA (Allrun, Shanghai, China), the MiniBEST Bacterial Genomic DNA Extraction kits (Takara, Dalian, China), and the phenol-chloroform and boiling lysis methods. The concentration of the genomic DNA was measured using a spectrophotometer. The purity of the genomic DNA was evaluated by PCR amplification of 16S rDNA followed by determining the cloning efficiency of the amplicon into the pMD19-T vector. Furthermore, the bacterial DNA quality was also evaluated by PCR assays using a pair of species-specific primers for Vibrio parahaemolyticus. Our results showed that the two commercial kits produced the highest purity of DNA, but with the lowest yields. The phenol-chloroform method produced the highest yield although it was time-consuming. The boiling lysis method was simple and cost effective; however, it was only suitable to isolate genomic DNA from bacteria present in retail samples following an enrichment step. The two commercial kits were good candidates for genomic DNA extraction from retail oyster tissues without enrichment.

show abstract

Methods of Virus Detection in Foods

Goyal

2006

Viruses in Foods

View full text Add to dashboard Cite

Adenovirus detection in shellfish and urban sewage in Morocco (Casablanca region) by the polymerase chain reaction

Cited by 23 publications

References 16 publications

Detection of enterovirus in mussels from Morocco by cell culture and real-time PCR

Detection of enterovirus in mussels from Morocco by cell culture and real-time PCR

http://www.omicsonline.org/open-access/overcoming-pseudomonas-aeruginosa-resistance-caused-by-glycocalyx-with-tobracef-1948-5948.1000145.php?aid=25925

Methods of Virus Detection in Foods

Contact Info

Product

Resources

About