Altered SMRT levels disrupt vitamin D3 receptor signalling in prostate cancer cells

Abstract

We hypothesized that key antiproliferative target genes for the vitamin D receptor (VDR) were repressed by an epigenetic mechanism in prostate cancer cells resulting in apparent hormonal insensitivity. To explore this possibility, we examined nuclear receptor corepressor expression in a panel of nonmalignant and malignant cell lines and primary cultures, and found frequently elevated SMRT corepressor mRNA expression often associated with reduced sensitivity to 1a,25-dihydroxyvitamin D 3 (1a,25(OH) 2 D 3 ). For example, PC-3 and DU-145 prostate cancer cell lines had 1.8-fold and twofold increases in SMRT mRNA relative to normal PrEC cells (Po0.05). Similarly, 10/15 primary tumour cultures (including three matched to normal cells from the same donors) had elevated SMRT mRNA levels; generally NCoR1 and Alien were not as commonly elevated. Corepressor proteins often have associated histone deacetylases (HDAC) and reflectively the antiproliferative action of 1a,25(OH) 2 D 3 can be 'restored' by cotreatment with low doses of HDAC inhibitors such as trichostatin A (TSA, 15 nM) to induce apoptosis in prostate cancer cell lines. To decipher the transcriptional events that lead to these cellular responses, we undertook gene expression studies in PC-3 cells after cotreatment of 1a,25(OH) 2 D 3 plus TSA after 6 h. Examination of known VDR target genes and cDNA microarray analyses revealed cotreatment of 1a,25(OH) 2 D 3 plus TSA cooperatively upregulated eight (outof1176)genes,includingMAPK-APK2andGADD45a. MRNA and protein time courses and inhibitor studies confirmed these patterns of regulation. Subsequently, we knocked down SMRT levels in PC-3 cells using a small interfering RNA (siRNA) approach and found that GADD45a induction by 1a,25(OH) 2 D 3 alone became very significantly enhanced. The same distortion of gene responsiveness, with repressed induction of GADD45a was found in primary tumour cultures compared and to matched peripheral zone (normal) cultures from the same donor. These data demonstrate that elevated SMRT levels are common in prostate cancer cells, resulting in suppression of target genes associated with antiproliferative action and apparent 1a,25(OH) 2 D 3 -insensitivity. This can be targeted therapeutically by combination treatments with HDAC inhibitors.

The vitamin D receptor in cancer

“…The expression, localization and isoforms of co-repressor complexes have emerged as critical in determining the spatio-temporal equilibrium between the antagonistic actions of the apo and holo nuclear receptor complexes, and thus determine target gene promoter responsiveness in a range of physiological and pathological settings (79)(80)(81) .…”

Altered Nuclear Receptor Corepressor Expression Attenuates Vitamin D Receptor Signaling in Breast Cancer Cells

“…This assay has proved to yield a linear relationship between ATP levels in a test well and a wide range of cell numbers. Therefore, inhibition of proliferation can be readily measured in test wells by measuring the decrease in ATP levels relative to untreated wells (20).…”

“…The interactions of two compounds were assessed by measuring the mean effect of either compound acting alone (F SE; refs. 20,21,33). The combination of the mean effect for each compound acting alone was the predicted combined inhibition.…”

“…All reactions were multiplexed with preoptimized control primers to ensure parallel amplification with VIC-labeled probe for 18S rRNA (Perkin-Elmer Biosystems, Warrington, United Kingdom). Primer and probe sequences were previously described (20) and were designed for the current study [VDUP-1 forward primer, GCCTGC-TGATTGTCATGGAA; VDUP-1 reverse primer, TGGTCTCCTCGA-TCCTGGAT; VDUP-1 probe, TTTGACGGTGGAGAACTCTTTAGCCGT] or were provided from Assay-on-Demand (cytokeratin 19, Perkin-Elmer Biosystems). Reactions were cycled as follows: 50jC for 2 minutes, 95jC for 10 minutes; then 44 cycles of 95jC for 15 seconds and 60jC for 1 minute.…”

“…We have previously proposed and investigated epigenetic mechanisms as the basis for corruption of VDR signaling in prostate cancer (20,21). In the current study, we have used these findings for the basis of investigation of nuclear receptor corepressor expression and activity to derive breast cancer insensitivity towards 1a,25(OH) 2 D 3 .…”