Alternative Core Promoters Regulate Tissue-specific Transcription from the Autoimmune Diabetes-related ICA1 (ICA69) Gene Locus

Abstract

Islet cell autoantigen 69-kDa (ICA69), protein product of the human ICA1 gene, is one target of the immune processes defining the pathogenesis of Type 1 diabetes. We have characterized the genomic structure and functional promoters within the 5-regulatory region of ICA1. 5-RNA ligase-mediated rapid amplification of cDNA ends evaluation of ICA1 transcripts expressed in human islets, testis, heart, and cultured neuroblastoma cells reveals that three 5-untranslated region exons are variably expressed from the ICA1 gene in a tissue-specific manner. Surrounding the transcription initiation sites are motifs characteristic of non-TATA, non-CAAT, GC-rich promoters, including consensus Sp1/GC boxes, an initiator element, cAMP-responsive element-binding protein (CREB) sites, and clusters of other putative transcription factor sites within a genomic CpG island. Luciferase reporter constructs demonstrate that the first two ICA1 exon promoters reciprocally stimulate luciferase expression within islet-(RIN 1046-38 cells) and brain-derived (NMB7) cells in culture; the exon A promoter exhibits greater activity in islet cells, whereas the exon B promoter more efficiently activates transcription in neuronal cells. Mutation of a CREB site within the ICA1 exon B promoter significantly enhances transcriptional activity in both cell lines. Our basic understanding of expression from the functional core promoter elements of ICA1 is an important advance that will not only add to our knowledge of the ICA69 autoantigen but will also facilitate a rational approach to discover the function of ICA69 and to identify relevant ICA1 promoter polymorphisms and their potential associations with disease.

Islet Cell Autoantigen of 69 kDa Is an Arfaptin-related Protein Associated with the Golgi Complex of Insulinoma INS-1 Cells

“…Thus, our findings raise the possibility that ICA69 acts in concert with small GTPases in regulating membrane dynamics at the Golgi complex and ISGs. The wide tissue expression of ICA69 (1,4,5), suggests that this regulation may not be restricted to neuroendocrine cells.…”

“…Like most antigens of type 1 diabetes, ICA69 is enriched in pancreatic ␤-cells and neurons (4). Use of alternative exons in the 5Ј-untranslated region of the ICA69 gene can affect its tissue expression (5). Although ICA69 deficiency in mice does not induce any obvious phenotype, the knockout of its C. elegans homologue compromises neurotransmission (3,6).…”

Sequence Variation in Promoter of Ica1 Gene, Which Encodes Protein Implicated in Type 1 Diabetes, Causes Transcription Factor Autoimmune Regulator (AIRE) to Increase Its Binding and Down-regulate Expression

“…Generation and Subcloning of Constructs-We have previously characterized the human ICA1 promoter region (18). Based on our previous findings and DNA sequence similarity with human ICA1, specific primers were designed for the putative mouse Ica1 promoter element as follows: 5Ј primer, GAATTCTTATATTTTCATGTAATT; 3Ј primer, GAGTGT-GAATTTCATAATCGTG.…”

“…To allow for normalization of firefly luciferase values based on transfection efficiency, the co-reporter vector pRL-TK expressing Renilla luciferase was included in the transfection mixture at a ratio of 1:10 (co-reporter plasmid/experimental promoter construct) as reported previously (18).…”

“…Amplified PCR products from NOD and C57BL/6 genomic DNA were directly subcloned into the pCRII-TOPO vector (Original TA Cloning Kit, Invitrogen) following the manufacturer's protocol. Cloning of Ica1 promoter elements was performed using the pGL3-Basic vector as described previously and later used in the luciferase assays (18). The pGL3 vectors containing the Ica1 promoter elements were sequence-verified utilizing a series of overlapping primer sets at the University of Michigan Sequencing Core.…”