An easy, simple inexpensive test for the specific detection of Pectobacterium carotovorum subsp. carotovorum based on sequence analysis of the pmrA gene

Abstract

BackgroundThe species Pectobacterium carotovorum includes a diverse subspecies of bacteria that cause disease on a wide variety of plants. In Morocco, approximately 95% of the P. carotovorum isolates from potato plants with tuber soft rot are P. carotovorum subsp. carotovorum. However, identification of this pathogen is not always related to visual disease symptoms. This is especially true when different pathogen cause similar diseases on potato, citing as an example, P. carotovorum, P. atrosepticum and P. wasabiae. Numerous conventional methods were used to characterize Pectobacterium spp., including biochemical assays, specific PCR-based tests, and construction of phylogenetic trees by using gene sequences. In this study, an alternative method is presented using a gene linked to pathogenicity, in order to allow accuracy at subspecies level. The pmrA gene (response regulator) has been used for identification and analysis of the relationships among twenty nine Pectobacterium carotovorum subsp. carotovorum and other Pectobacterium subspecies.ResultsPhylogenetic analyses of pmrA sequences compared to ERIC-PCR and 16S rDNA sequencing, demonstrated that there is considerable genetic diversity in P. carotovorum subsp. carotovorum strains, which can be divided into two distinct groups within the same clade.ConclusionspmrA sequence analysis is likely to be a reliable tool to identify the subspecies Pectobacterium carotovorum subsp. carotovorum and estimate their genetic diversity.

Identification and Biological Properties of the Pathogen of Soft Rot of Tomatoes in the Greenhouse

“…Whereas the isolates showed the ability to hydrolyze β-glucosidase, gelatins and citrates, inositol and D-sorbitol assimilation tests were negative, although bacterial strains had the ability to use Dglucose, L-arabinose, D-mannitol, D-sucrose, D-melibiose, amygdalin, and L-rhamnose. Similar results are presented in the works of Terta et al [32], Kettani-Halabi et al [33] and are considered as diagnostic biochemical signs.…”

Identification and genetic diversity of Jordanian potato soft rot isolates, Pectobacterium carotovorum subspecies carotovorum (DYE 1969)

“…The Pcc Jo-isolates were strongly differentiated from other Pectobacterium responsible for disease in potato including Pca. Kettani-Halabi et al (2013) indicated that pmrA sequence analysis was a reliable tool for detection and identification of Pcc and to determine genetic diversity. The Pcc Jo-isolates from different regions did not cluster according to locations and this could be attributed to the fact that potato seeds in Jordan are mainly from one source.…”

“…The isolates were subjected to PCR amplification using pmrA primer set: F0145: TACCCTGCAGATGAAATTATTGATT-GTTGAAGA; E2477: TACCAAGCTTTGGTTGTTCCCCTTTGGTCA (Kettani-Halabi et al, 2013). Primers were designed based on the sequence of pmrA gene in Erwinia species.…”

“…DNA markers have been used for the rapid detection of different strains of P. carotovorum subspecies carotovorum (Pcc) (Kang et al, 2003;Zhu et al, 2010;Rahmanifer et al, 2012;Azadmanesh et al, 2013). DNA sequence analysis of gene pmrA, which is linked to pathogenicity (response regulator), was used to evaluate the relationship among Pcc isolates collected from different regions of Morocco and results were equivalent to enterobacterial repetitive intergenic consensuspolymerase chain reaction (ERIC-PCR) and 16S rDNA sequencing (Kettani-Halabi et al, 2013).…”

Genomic Insights of Pectobacterium carotovorum Strain M022 Quorum-Sensing Activity through Whole-Genome Sequencing

“…Plant pathogens have been a threat to crops and pose a danger to food security. Potato blackleg, which is caused by various soft rot coliforms such as Pectobacterium ( 1 ), is one of the major concerns worldwide. Plant pathogenic characteristics, such as production of virulence factors, can be regulated from their communication, which is also known as quorum sensing (QS) ( 2 , 3 ).…”