An Optimized microRNA Backbone for Effective Single-Copy RNAi

Abstract

Short hairpin RNA (shRNA) technology enables stable and regulated gene repression. For establishing experimentally versatile RNAi tools and minimizing toxicities, synthetic shRNAs can be embedded into endogenous microRNA contexts. However, due to our incomplete understanding of microRNA biogenesis, such "shRNAmirs" often fail to trigger potent knockdown, especially when expressed from a single genomic copy. Following recent advances in design of synthetic shRNAmir stems, here we take a systematic approach to optimize the experimental miR-30 backbone. Among several favorable features, we identify a conserved element 3' of the basal stem as critically required for optimal shRNAmir processing and implement it in an optimized backbone termed "miR-E", which strongly increases mature shRNA levels and knockdown efficacy. Existing miR-30 reagents can be easily converted to miR-E, and its combination with up-to-date design rules establishes a validated and accessible platform for generating effective single-copy shRNA libraries that will facilitate the functional annotation of the genome.

CDK9-mediated transcription elongation is required for MYC addiction in hepatocellular carcinoma

“…27990, or on request) (Zuber et al 2011a;Fellmann et al 2013). To produce Tet-on murine HCC MP1 cells, liver progenitor cells from p53 Loxp/Loxp mice were transduced with CreER and Myc-IRES-rtTA3.…”

“…Control (Renilla and Myc) and Cdk9 shRNAs were subcloned into miR-E, an optimized miR-30-based backbone that increases knockdown efficiency, particularly for those shRNAs with intermediate potency (Supplemental Fig. 2B,C;Fellmann et al 2013). All three experimental murine HCC cell lines that overexpressed Myc (MP1, MP-CH, and Myc-AL) were highly sensitive to Cdk9 inhibition, while murine HCC cells expressing mutant Kras G12D , Hepa1-6 hepatoma cells, NIH-3T3 fibroblasts, and iMEFs showed modest to no sensitivity (Fig.…”

Expansion of BCR/ABL1+ cells requires PAK2 but not PAK1

“…No changes in PAK1 and PAK2 levels were detectable (Fig S3). Stable knockdown of PAK1 , PAK2 , or both genes was achieved using an established, miR30‐shRNA‐based system (Zuber et al , 2011; Fellmann et al , 2013; Putz et al , 2013, 2014; Berger et al , 2014; Scheicher et al , 2015). Knockdown efficiencies were verified by qPCR and immunoblotting (Fig 2A and B).…”

A novel Atg5-shRNA mouse model enables temporal control of Autophagy in vivo

“…However, it is important to note any possibility of off-target effects of the RNAi in this system. Whereas our model exploits a recently developed inducible shRNA system, wherein the shRNA is expressed in a miR-E cassette to allow physiological processing and reduced off-target effects [22], currently we only use one targeting sequence. As such it will be important to develop further RNAi models targeting alternative sequences of Atg5 , or other key autophagy genes, for further validation of newly described phenotypes.…”

“…We tested knockdown efficiency of those shRNAs in NIH3T3 cells, and an shRNA showing the strongest knockdown even with the highest dilution (1% v:v) viral supernatant was taken forward for LSL-ATG5i mouse generation by Mirimus Inc. Briefly, the shRNA ( Atg5 _ 1065; Guide sequence: TATGAAGAAAGTTATCTGGGTA) in a miR-E design (an improved design variant of miR30) [22] was inserted downstream of the Col1a1 locus via recombinase-mediated cassette exchange which enables efficient targeting of a transgene to a specific genomic site 500 base pairs downstream of the 3ʹ UTR in D34 ES cells expressing CAG-rtTA3 knocked into the Rosa26 locus (Fig. S1) [29,30].…”