Analysis of the Genetic Diversity of the European Bison (Bison bonasus) Population in Lithuania

Lapickis, Romualdas; Griciuvienė, Loreta; Kibiša, Artūras; Lipatova, Indrė; Aleksandravičienė, Asta; Ražanskė, Irma; Wojciechowska, Marlena; Kloch, Marta; Olech, Wanda; Paulauskas, Algimantas

doi:10.3390/d15030406

Cited by 1 publication

(2 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…211-215 [30] 211-215 [32] 213-221 [34] 211-215 [35] 208-212 [36] 3 [10] 3 [30] 3 [32] 4 [34] 3 [35] 3 [36] F: GTTCAGGACTGGCCCTGCTAACA R: CCTCCAGCCCACTTTCTCTTCTC 29. ETH121 186-214 [39] 5 [39] F: CCAACTCCTTACAGCAAATGTC R: ATTTAGAGCTGGCTGGTAAGTG 30. ETH152 197-203 [35] 3 [35] 3 [26] 5 [38] F: TACTCGTAGGGCAGGCTGCCTG R: GAGACCTCAGGGTTGGTGATCAG 31.…”

Section: Eth10mentioning

confidence: 99%

See 1 more Smart Citation

Application of microsatellite analysis in genetic studies of the European (<i>Bison bonasus</i>)

Churbakova,

Kharzinova,

Koshkina

et al. 2024

jour

View full text Add to dashboard Cite

Purpose: to summarise the results of the genetic diversity studies of the European bison (Bison bonasus) using microsatellite analysis method.Materials and methods. NCBIs PubMed Database (https://pubmed.ncbi.nlm.nih.gov/) and scientific electronic library eLIBRARY.RU (https://elibrary.ru/).Results. Many studies have been devoted to the maintenance of genetic diversity of the European bison. To date, most studies in the field based on evaluation of pedigree data and on the use of nuclear and mitochondrial markers. Assessment of genetic diversity and population structure, control inbreeding level of captive-bred groups is one of the main tasks in the conservation and reproduction of rare species. This is due to the fact that in such groups there is a decrease in genetic variability, which affects the adaptation and survival of individuals reintroduced to the wild. The first genetic studies of wisent began with the analysis of blood groups in the 1960s. With the discovery of DNA structure and the development of methods for determining its variability, the study of protein polymorphism was replaced by the analysis of the nucleotide sequence in a DNA molecule. Microsatellites, single-nucleotide polymorphisms and mitochondrial DNA have become widespread in studies of the genetic structure of wisent. One of the important criteria for DNA markers, is to reduce the cost of analysis and availability for routine use. In this regard, in our study, we paid more attention to a more cost-effective method, which is the analysis of microsatellite loci. A total of 48 microsatellite loci were successfully amplified for the European bison population. The multiplex panels of microsatellite markers developed for cattle (Bos taurus) were mainly used. At the same time, the spectrum and number of loci in the studies of different authors were not the same. The only exception was the BM1824 locus, which was used by almost all research teams. The number of alleles per locus varied from 1 to 6. Most of the loci considered are characterised by a low number of alleles, which makes it difficult to assess the actual indicator of the level of inbreeding in the European bison populations. In this connection, it is necessary to search for new, previously unexplored, highly polymorphic loci for estimating the genetic diversity of wisent, which will allow not only a more detailed description of the current state of genetic diversity, the level of genomic inbreeding, but also an assessment of the degree of lineage differentiation, and will help to identify the presence of hybridisation with the North American bison (Bison bison bison) and the cattle (Bos taurus).

show abstract

Section: Eth10mentioning

confidence: 99%

“…69-71 [30] 69 [32] 74 [35] 2 [30] 1 [32] 1 [35] 1 [39] F: CGAATTCCAAATCTGTTAATTTGCT R: ACAGACAGAAACTCAATGAAAGCA Churbakova N., Kharzinova V., Koshkina O., Volkova V.…”

Section: Tgla227mentioning

confidence: 99%