Application of conventional and real-time fluorescent ITS1 rDNA PCR for detection of Besnoitia besnoiti infections in bovine skin biopsies

Cortes, Hélder; Reis, Y.; Gottstein, Bruno; Hemphill, Andrew; Leitão, Alexandre; Müller, Norbert

doi:10.1016/j.vetpar.2007.03.003

Cited by 57 publications

(47 citation statements)

References 10 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…BesITS1F: TGACATTTAATAACAATCAACCCTT (Cortes et al 2007), BesITS1R: GGTTTGTATTAACCAATCCGTGA (Cortes et al 2007). …”

Section: Methodsmentioning

confidence: 99%

“…However, their life cycle is not known in several cases, while in others, only scarce data are available, although the transmission in the life cycles had been described in Besnoitia akondoni, Besnoitia darlingi, and Besnoitia orytofelisi (see review Mehlhorn et al 2009). Besnoitia besnoiti from cattle was originally described by Besnoit and Robin (1912) in France but became confirmed to occur in Israel, Southern Europe, Kasachstan, and South Korea, too (Heydorn et al 1984;Cortes et al 2006aCortes et al , b, 2007Buchev et al 2007;Bak et al 1968). Other species apparently occur in the USA in a variety of hosts (Dubey et al 2002Dubey and Lindsay 2003).…”

Section: Introductionmentioning

confidence: 94%

See 1 more Smart Citation

Molecular biological comparison of different Besnoitia species and stages from different countries

et al. 2010

View full text Add to dashboard Cite

Besnoitia besnoiti tissue cysts from a recent outbreak in cattle in Germany were characterized with respect to their internal transcribed spacer regions 1, 2, and 18S rDNA gene sequences. These results were compared with own sequences of an Israelian isolate of B. besnoiti and of Besnoitia jellisoni cystozoites stored for years in liquid nitrogen. Furthermore, material was studied that was obtained from white mice (Balb/C) that had been successfully infected by intraperitoneal infection of fresh cystozoites from the German outbreak. All results were then compared and discussed with respect to databank sequences of other Besnoitia species. Comprehensive phylogenetic studies of B. besnoiti isolates from Germany revealed almost identical sequence alignments when compared to previously sequenced B. besnoiti isolates from Israel and Spain. More importantly, phylogenetic analysis revealed two distant clusters of Besnoitia species: the first one includes Besnoitia akodoni, Besnoitia darlingi, and Besnoitia oryctofelisi, while the second cluster includes B. besnoiti, Besnoitia bennetti, Besnoitia tarandi, and the Besnoitia species of rodents (B. jellisoni). The also B. jellisoni named species of the GenBank (AF 076860) must be another one, since our strain derives directly from Frenkel. These findings give strong hints that B. besnoiti has a cycle between rodents and a predator and that cattle and other are only accidental hosts.

show abstract

“…BesITS1F: TGACATTTAATAACAATCAACCCTT (Cortes et al 2007), BesITS1R: GGTTTGTATTAACCAATCCGTGA (Cortes et al 2007). …”

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 94%

Molecular biological comparison of different Besnoitia species and stages from different countries

et al. 2010

View full text Add to dashboard Cite

show abstract

“…Heydorn et al 1984;Njenga et al 1995, Njagi et al 1998Shkap et al 1988;Ellis et al 2000). However, infected animals were also detected in Portugal (Cortes et al 2006a(Cortes et al , b, 2007Reis et al 2006) without hints, how this disease may have crossed the Mediterranean Sea. Just recently, Fernandez-Garcia et al (2008) succeeded in the first detection of cattle besnoitiosis in Central Spain and described clearly the stages of this parasite during the chronic phase of the disease in a cow and presented tissue cysts, cyst-stages and some of their molecular biological features.…”

Section: Introductionmentioning

confidence: 98%

“…Besnoitia besnoiti is a cystforming coccidian protozoan with an unknown life cycle, although the cysts that occur in infected ruminants are well described by light and transmission electron microscopy (Scholtyseck et al 1973;Mehlhorn et al 1974;D'Haese et al 1977;Heydorn et al 1984;Njenga et al 1995;Cortes et al 2007;Mehlhorn 2008). Many investigations confirmed that this species induces the so-called elephant-skin of cattle in Africa and Israel representing the leading symptom of the chronic phase of this disease, which is further characterized by hyposclerodermia, hyperkeratosis, alopecia, and local infections of the eyes, the ears, the legs and of spots along the back.…”

Section: Introductionmentioning

confidence: 99%

Another African disease in Central Europa: Besnoitiosis of cattle. I. Light and electron microscopical study

et al. 2008

View full text Add to dashboard Cite

The paper reports the first detection of besnoitiosis of cattle in Germany. Just 2 years after the first appearance of the African Bluetongue disease (BTD) of cattle in Central Europe, another African agent of disease has arrived in Germany. While it was proven that the BTD virus was transmitted (after its first appearance) by endemic midges of the genus Culicoides (C. obsoletus, C. pulicaris), nothing is known, how the infectious stages of Besnoitia besnoiti-a member of the so-called cyst-forming coccidia-found their way to a herd in Southern Germany. The infected animals showed all characteristic clinical symptoms of besnoitiosis such as hyposclerodermia, hyperkeratosis, alopecia, and whitish tissue cysts in subcutaneous tissues as well as in the cornea. These cysts had diameters of up to 3 mm and consisted of a dense outer layer (=secondary cyst wall), which surrounded a host cell, that had been enormously enlarged by an inner parasitophorous vacuole containing thousands of 7-9 x 2 mum sized, banana-shaped cyst merozoites (=cystozoites, bradyzoites).Their fine structure was identical to that of published stages of B. besnoiti. During cyst development, the nucleus of the host cell had been hypertrophied and had apparently undergone several divisions, since many flattened, but very large nuclei were seen in light and electron microscopy. Thus, this study proves the arrival of another serious agent of disease of ruminants in Central Europe-a fact which is especially important, since in this species, there is neither information on the way of transmission from animal to animal nor exists concrete information on an efficacious therapy or on the modalities of its import into Germany.

show abstract

“…Current diagnostic techniques include histopathology (Basson et al, 1970), cytology from scleral conjunctiva (Sannusi, 1991) or vaginal mucosa , PCR testing (Cortes et al, 2007b) and several serological assays. The immunofluorscence test (Janitschke et al, 1984;Shkap et al, 2002) is generally accepted as the reference assay and, although laborious and dependant on the reader, is widely used in the diagnosis of B. besnoiti infection.…”

Section: Introductionmentioning

confidence: 99%

A modified agglutination test for the diagnosis of Besnoitia besnoiti infection

Waap

Cardoso

Marcelino

et al. 2011

Veterinary Parasitology

Self Cite

View full text Add to dashboard Cite

Bovine besnoitiosis is caused by Besnoitia besnoiti, an obligate intracellular apicomplexan parasite. Affected animals present cutaneous and systemic manifestations and the disease may lead to considerable economic losses. Although generally associated to tropical and subtropical areas, bovine besnoitiosis is now considered an emergent disease in Europe, due to the increasing number of new cases and apparent geographical expansion. In this study we evaluated the performance of a modified agglutination test (B-MAT) in the serodiagnosis of bovine besnoitiosis in comparison to the indirect immunofluorescent-antibody test (IFAT). To establish optimal protocol conditions we used bovine sera with a known infection status for B. besnoiti infection. Positive animals (n=36) presented B. besnoiti dermal cysts and anti-B. besnoiti specific antibodies, as determined by the indirect immunofluorescence test (IFAT). Negative animals (n=103) were from non-endemic areas in Portugal and negative by the IFAT. From here, we evaluated the sensitivity and specificity of the B-MAT relative to the IFAT with a panel of sera from herds with history of bovine besnoitiosis in Portugal, Spain and France (n=402), using three serum dilutions (1:80, 1:160, 1:320). Considering the positive cut-off at 1:160 serum dilution, the B-MAT showed an almost perfect test agreement with the IFAT; (κ=0.968; 95% CI: 0.941-0.996) with a relative sensitivity of 97.2% (95% CI: 94.1-100%) and a relative specificity of 99.3% (95% CI: 98.4-100%). As a simple and inexpensive technique the B-MAT represents a valuable tool for the diagnosis and study of the epidemiology of bovine besnoitiosis.

show abstract

Application of conventional and real-time fluorescent ITS1 rDNA PCR for detection of Besnoitia besnoiti infections in bovine skin biopsies

Cited by 57 publications

References 10 publications

Molecular biological comparison of different Besnoitia species and stages from different countries

Molecular biological comparison of different Besnoitia species and stages from different countries

Another African disease in Central Europa: Besnoitiosis of cattle. I. Light and electron microscopical study

A modified agglutination test for the diagnosis of Besnoitia besnoiti infection

Contact Info

Product

Resources

About