Appraisal of levels and patterns of occupational exposure to 1,3-butadiene

Scarselli, Alberto; Corfiati, Marisa; D, Di Marzi; Iavicoli, Sergio

doi:10.5271/sjweh.3644

Cited by 15 publications

(12 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Co-exposures to benzene, 1,3-butadiene and PAHs (cluster n° 4) are well known among oil refinery workers, even if exposure levels are currently low [ 20 , 21 ]. However, a similar pattern of exposure can also occur in the service sector, with a share in women too as reported in a previous study [ 17 ]. In the present study, this co-exposure pattern among women (cluster n° 4) was found mainly in the sector of gambling and betting activities, for exposures coming from secondhand smoke.…”

Section: Discussionsupporting

confidence: 79%

“…In our study, exposure levels to hardwood dust were higher in male workers, while women had higher levels of exposure to formaldehyde, a chemical recently added in the carcinogens list of EU. A study based on SIREP data has shown higher mean exposure levels to formaldehyde in sectors with a higher proportion of women exposed such as wood industry and healthcare [ 17 ]. The concurrent occupational exposure to hardwood dust and formaldehyde emerges as a critical issue, involving, according to our data, a relevant number of women too, mainly in small-size enterprises.…”

Section: Discussionmentioning

confidence: 99%

“…The main limitations of SIREP database are the inhomogeneous territorial coverage and the under-representation of some economical activities, as already underlined in previous studies [ 15 , 17 , 23 ]. Data collection and reporting for the SIREP database are under the responsibility of the employer, and we observed that the number of exposure measurements differed by industrial sector and workforce size.…”

Section: Discussionmentioning

confidence: 99%

See 2 more Smart Citations

Gender differences in occupational exposure to carcinogens among Italian workers

et al. 2018

Self Cite

View full text Add to dashboard Cite

BackgroundMany carcinogenic chemicals are still used or produced in several economic sectors. The aim of this study is to investigate differences in occupational exposure patterns to carcinogens by gender in Italy.MethodsInformation about the most common carcinogens recorded in the Italian occupational exposures database (SIREP) for the period 1996–2015 was retrieved. Descriptive statistics were calculated for exposure-related variables (carcinogenic agent, occupational group, economic activity sector, and workforce size). The chi-square(χ2) test was used to verify differences between genders, and logistic regression analysis was performed to evaluate the association between gender and risk of having higher exposure levels, after adjusting for age. Concurrent exposures to multiple carcinogens were investigated using the two-step cluster analysis.ResultsA total of 166,617 exposure measurements were selected for 40 different carcinogens. Exposed workers were only in a small proportion women (9%), and mostly aged 20–44 years (70%) in both genders. Women were more likely to be exposed than men to higher levels for several carcinogens even after correction for age at exposure, and the exposure level was significantly (p < 0.01) associated with occupation, economic sector and workforce size. The five main clusters of co-exposures identified in the entire dataset showed a differential distribution across economic sectors between genders.ConclusionsThe exposures to occupational carcinogens have distinguishing characteristics in women, that are explained in part by work and job segregation. Because of the presence of high-exposed groups of female workers in many industrial sectors, further research and prevention efforts are recommended.

show abstract

Section: Discussionsupporting

confidence: 79%

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Gender differences in occupational exposure to carcinogens among Italian workers

et al. 2018

Self Cite

View full text Add to dashboard Cite

show abstract

“…The association between occupational exposure to 1,3-butadiene and the occurrence of cancers of hematolymphatic organs, mainly leukemia, was observed in large occupational cohort studies (Orozco et al, 2019; Sadeghi-Yarandi et al, 2020). The International Agency for Research on Cancer (IARC) has identified this chemical agent as carcinogenic to human by inhalation (Scarselli et al, 2017). In addition, previous studies have shown that some metabolites of 1,3-butadiene (like monoepoxide, diepoxide, and epoxydiol) are suspected of causing genetic defects.…”

Section: Introductionmentioning

confidence: 99%

Cancer and non-cancer health risk assessment of occupational exposure to 1,3-butadiene in a petrochemical plant in Iran

et al. 2020

View full text Add to dashboard Cite

1,3-Butadiene is classified as carcinogenic to humans by inhalation. This study aimed to assess cancer and non-cancer risk following occupational exposure to 1,3-butadiene. This cross-sectional study was conducted in a petrochemical plant producing acrylonitrile butadiene styrene copolymer in Iran. Occupational exposure to 1,3-butadiene was measured according to the National Institute for Occupational Safety and Health 1024 method. Cancer and non-cancer risk assessment were performed according to the United States Environmental Protection Agency method. The average occupational exposure to 1,3-butadiene during work shifts among all participants was 560.82 ± 811.36 µg m−3. The average lifetime cancer risk (LCR) in the present study was 2.71 × 10−3; 82.2% of all exposed workers were within the definite carcinogenic risk level. Also, the mean non-cancer risk (hazard quotient (HQ)) among all participants was 10.82 ± 14.76. The highest LCR and HQ were observed in the safety and fire-fighting station workers with values of 7.75 × 10−3 and 36.57, respectively. The findings revealed that values of carcinogenic and noncarcinogenic risk in the majority of participants were within the definitive and unacceptable risk levels. Therefore, corrective measures are necessary to protect these workers from non-cancer and cancer risks from 1,3-butadiene exposure.

show abstract

“…1,2:3,4‐Diepoxybutane (DEB) is the most potent active metabolite of the environmental chemical 1,3 butadiene (BD) [1] . BD is a regulated hazardous air pollutant that is genotoxic, mutagenic, and carcinogenic [1–4] . Human exposure to BD occurs through inhalation of the compound found at industrial sites, in automobile exhaust, cigarette smoke, and forest fires.…”

Section: Introductionmentioning

confidence: 99%

Diepoxybutane induces the expression of a novel p53‐target gene XCL1 that mediates apoptosis in exposed human lymphoblasts

Ewunkem

Deve

Harrison

et al. 2020

J Biochem & Molecular Tox

View full text Add to dashboard Cite

Diepoxybutane (DEB) is the most potent active metabolite of the environmental chemical 1,3‐butadiene (BD). BD is a human carcinogen that exhibits multiorgan systems toxicity. Our previous studies demonstrated that the X‐C motif chemokine ligand 1 (XCL1) gene expression was upregulated 3.3‐fold in a p53‐dependent manner in TK6 lymphoblasts undergoing DEB‐induced apoptosis. The tumor‐suppressor p53 protein is a transcription factor that regulates a wide variety of cellular processes, including apoptosis, through its various target genes. Thus, the objective of this study was to determine whether XCL1 is a novel direct p53 transcriptional target gene and deduce its role in DEB‐induced toxicity in human lymphoblasts. We utilized the bioinformatics tool p53scan to search for known p53 consensus sequences within the XCL1 promoter region. The XCL1 gene promoter region was found to contain the p53 consensus sequences 5′‐AGACATGCCTAGACATGCCT‐3′ at three positions relative to the transcription start site (TSS). Furthermore, the XCL1 promoter region was found, through reporter gene assays, to be transactivated at least threefold by wild‐type p53 promoter in DEB‐exposed human lymphoblasts. Inactivation of the XCL1 promoter p53‐binding motif located at −2.579 kb relative to TSS reduced the transactivation function of p53 on this promoter in DEB‐exposed cells by 97%. Finally, knockdown of XCL1 messenger RNA with specific small interfering RNA inhibited DEB‐induced apoptosis in human lymphoblasts by 50%. These observations demonstrate, for the first time, that XCL1 is a novel DEB‐induced direct p53 transcriptional target gene that mediates apoptosis in DEB‐exposed human lymphoblasts.

show abstract

Appraisal of levels and patterns of occupational exposure to 1,3-butadiene

Cited by 15 publications

References 22 publications

Gender differences in occupational exposure to carcinogens among Italian workers

Gender differences in occupational exposure to carcinogens among Italian workers

Cancer and non-cancer health risk assessment of occupational exposure to 1,3-butadiene in a petrochemical plant in Iran

Diepoxybutane induces the expression of a novel p53‐target gene XCL1 that mediates apoptosis in exposed human lymphoblasts

Contact Info

Product

Resources

About