ATDC5 cells as a model of cartilage extracellular matrix neosynthesis, maturation and assembly

Wilhelm, Dafné; Kempf, Hervé; Bianchi, Arnaud; Vincourt, Jean‐Baptiste

doi:10.1016/j.jprot.2020.103718

Cited by 15 publications

(11 citation statements)

References 60 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…To question the specific function of P4HA2, the corresponding gene was invalidated in the widely used chondrogenesis model relying on ATDC5 cells [31, 32], which we found recapitulate many aspects of collagen biogenesis and assembles massive type I collagen [33]. mRNA studies show robust expression of P4ha1-3 in control ATDC5 cells (compared to mouse tissues) and near extinction of P4ha2 upon dedicated CRISPR/Cas9-mediated invalidation, without changes of P4ha1 or P4ha3 expression, cell growth or survival (supplemental data S3).…”

Section: Resultsmentioning

confidence: 99%

“…The ATDC5 model was used strictly as described in [33], except that for genome editing, 48 hours after plating, cells were inoculated overnight with 5.10 7 adenoviral constructs purchased from Vectorbuilder, transducing expression of a Cas9-GFP fusion protein together with selected gRNA, as follows: Controls were inoculated with a single-guided adenoviral CRISPR/Cas9 construct targeting human Hexose-6-Phosphate Dehydrogenase (gRNA sequence: CACCTGCGAAGGTCGGCGTC). Genetic invalidation of P4ha2 was induced similarly using the following gRNA sequence: AGATCAGCTGCCGACCCCGA.…”

Section: Cell Culture and Genome Editionmentioning

confidence: 99%

“…These aspects were managed mostly as described in [33] except that the intracellular fraction protein content was measured using the Bradford assay [43].…”

Section: Gene Expression Analysismentioning

confidence: 99%

See 2 more Smart Citations

Tissue-specific collagen hydroxylation at GEP/GDP triplets mediated by P4HA2

Wilhelm

WURTZ

ABOUELFARAH

et al. 2023

Preprint

Self Cite

View full text Add to dashboard Cite

Collagen, the most abundant organic compound of vertebrate organisms, is a supramolecular, protein-made polymer. Details of its post-translational maturation largely determine the mechanical properties of connective tissues. Its assembly requires massive, heterogeneous prolyl-4-hydroxylation (P4H), catalyzed by Prolyl-4-hydroxylases (P4HA1-3), providing thermostability to its elemental, triple helical building block. So far, there was no evidence of tissue-specific regulation of P4H, nor of a differential substrate repertoire of P4HAs. Here, the post-translational modifications of collagen extracted from bone, skin, and tendon were compared, revealing lower hydroxylation of most GEP/GDP triplets, together with fewer other residue positions along collagen α chains, in the tendon. This regulation is mostly conserved in two distant homeotherm species, mouse and chicken. The comparison of detailed P4H patterns in both species suggests a dual mechanism of specificity. P4ha2 expression is low in tendon and its genetic invalidation in the ATDC5 cellular model of collagen assembly specifically mimics the tendon-related P4H profile. Therefore, P4HA2 has a better ability than other P4HAs to hydroxylate the corresponding residue positions. Its local expression participates in determining the P4H profile, a novel aspect of the tissue specificities of collagen assembly.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Cell Culture and Genome Editionmentioning

confidence: 99%

See 1 more Smart Citation

Tissue-specific collagen hydroxylation at GEP/GDP triplets mediated by P4HA2

Wilhelm

WURTZ

ABOUELFARAH

et al. 2023

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

“…As prochondrocytes, ATDC5 cells differentiate in a similar way to cells that undergo chondrogenesis (16). ATDC5 cells are used as in vitro phytopharmacological models to reflect the complete process of chondrocyte proliferation, differentiation and mineralization during chondrogenesis (17). At present, the application of ATDC5 cells in OA research has been widely accepted (18)(19)(20).…”

Section: Discussionmentioning

confidence: 99%

DUSP4 alleviates LPS‑induced chondrocyte injury in knee osteoarthritis via the MAPK signaling pathway

Chen

2021

Exp Ther Med

View full text Add to dashboard Cite

Knee osteoarthritis (KOA) is characterized by cartilage damage, and the associated pathogenesis is complex. The expression of dual specificity protein phosphatase 4 (DUSP4) is significantly decreased in osteoarthritis (OA); however, the specific role and mechanism underlying DUSP4 in OA are yet to be elucidated. ATDC5 cells were treated with lipopolysaccharide (LPS) to establish the cell injury model. The expression levels of DUSP4 were decreased in OA chondrocytes, demonstrated by reverse transcription-quantitative PCR and western blot analysis. Following overexpression of DUSP4 by cell transfection, Cell Counting Kit-8, ELISA, TUNEL and western blotting assays were used to detect the cell viability, oxidative stress, inflammation and apoptosis levels of LPS-induced ATDC5 cells. Overexpression of DUSP4 inhibited the activation of the MAPK signaling pathway, thereby reducing oxidative stress levels, inflammatory response and apoptosis in the OA cell model. The mechanisms underlying DUSP4 in OA were further explored following the addition of MAPK signaling pathway agonist, phorbol 12-myristate 13-acetate (PMA). The addition of PMA reversed the inhibitory effects of DUSP4 overexpression on oxidative stress, inflammatory response and apoptosis in cells. In summary, DUSP4 alleviated LPS-induced chondrocyte injury in KOA via the MAPK signaling pathway.

show abstract

“…Lipopolysaccharide (LPS), a crucial metabolite and biomarker of gut microbiota, has been identified to cause the inflammation of OA [ 10 , 11 ]. ATDC5, a mouse teratocarcinoma-derived chondrogenic cell line, is regarded as an excellent in vitro cell model to explore the molecular mechanisms underlying chondrocyte biology, chondrogenesis, and skeletal development because it can recapitulate the main aspects of chondrocyte differentiation, cartilage extracellular matrix (ECM)-processing machinery, and synthesis of cartilage matrix [ 12 , 13 , 14 ]. LPS-treated ATDC5 cells have been used as an in vitro model to investigate the molecular basis of OA-related cartilage damage [ 15 , 16 ].…”

Section: Introductionmentioning

confidence: 99%

Hyaluronic Acid Oligosaccharide Derivatives Alleviate Lipopolysaccharide-Induced Inflammation in ATDC5 Cells by Multiple Mechanisms

et al. 2022

View full text Add to dashboard Cite

High molecular weight hyaluronic acids (HMW-HAs) have been used for the palliative treatment of osteoarthritis (OA) for decades, but the pharmacological activity of HA fragments has not been fully explored due to the limited availability of structurally defined HA fragments. In this study, we synthesized a series glycosides of oligosaccharides of HA (o-HAs), hereinafter collectively referred to as o-HA derivatives. Their effects on OA progression were examined in a chondrocyte inflammatory model established by the lipopolysaccharide (LPS)-challenged ATDC5 cells. CCK-8 assays and RT-qPCR showed that o-HA derivatives (≤100 μg/mL) exhibited no cytotoxicity and inflammatory effects. We found that the o-HA and o-HA derivatives alleviated LPS-induced inflammation, apoptosis, autophagy and proliferation-inhibition of ATDC5 cells, similar to the activities of HMW-HAs. Moreover, Western blot analysis showed that different HA derivatives selectively reversed the effects of LPS on the expression of extracellular matrix (ECM)-related proteins (MMP13, COL2A1 and Aggrecan) in ATDC5 cells. Our study suggested that o-HA derivatives may alleviate LPS-induced chondrocyte injury by reducing the inflammatory response, maintaining cell proliferation, inhibiting apoptosis and autophagy, and decreasing ECM degradation, supporting a potential oligosaccharides-mediated therapy for OA.

show abstract

ATDC5 cells as a model of cartilage extracellular matrix neosynthesis, maturation and assembly

Cited by 15 publications

References 60 publications

Tissue-specific collagen hydroxylation at GEP/GDP triplets mediated by P4HA2

Tissue-specific collagen hydroxylation at GEP/GDP triplets mediated by P4HA2

DUSP4 alleviates LPS‑induced chondrocyte injury in knee osteoarthritis via the MAPK signaling pathway

Hyaluronic Acid Oligosaccharide Derivatives Alleviate Lipopolysaccharide-Induced Inflammation in ATDC5 Cells by Multiple Mechanisms

Contact Info

Product

Resources

About