ATP9B, a P4-ATPase (a putative aminophospholipid translocase), localizes to the trans-Golgi network in a CDC50 protein-independent manner.

Abstract

PAGE 38161:The evidence shown in Fig. 1 that ATP10A is expressed in HeLa cells is not correct. ATP10A expression was measured using RT-PCR with the sense (ccttatccccagtcacagctg) and anti-sense (ccgagtctgcctcttggtacc) primer pair. However, subsequent cloning and sequencing of the RT-PCR product showed that the original primer pair amplified glucosidase, beta, acid (GBA, XM006726211.1) by annealing to the mRNA of GBA (XM006726211.1) at positions 541 and 823 (marked with an asterisk in the revised Fig. 1) rather than ATP10A mRNA. When we examined ATP10A expression using two other primer pairs (pair 1, cacaatgttcgtgggcctcc (sense) and aaggacactgaagccacacg (anti-sense); pair 2, gtctccgaattcaatcctttgac (sense) and ccgagtctgcctcttggtacc (anti-sense)), we detected ATP10A expression in MDA-MB-231 cells but not in HeLa cells (Fig. 1 Addendum). Therefore, we conclude that the band identified as ATP10A in the original Fig. 1 was a product of GBA mRNA amplification, and ATP10A expression was not detected in HeLa cells. This correction does not affect the results or conclusions of this work.

ATPase reaction cycle of P4‐ATPases affects their transport from the endoplasmic reticulum

“…Endogenous CDC50A was not coimmunoprecipitated with ATP9A or ATP9B proteins, or their mutants, confirming that the ATP9A or ATP9B protein does not interact with endogenous CDC50A (Fig. E) as well as exogenous CDC50A . As shown in Fig.…”

“…The CDC50A protein migrated as broad bands (Fig. , asterisks) due to a high level of N‐glycosylation . However, we hardly detected the CDC50A protein coimmunoprecipitated with ATP11A(GL), ATP11C(GL), and ATP10A(GL) mutants and with the DN mutants of all ATP11 and ATP10A.…”

“…ATP11A(WT), ATP11C(WT), and ATP10A(WT) localized to the plasma membrane and ATP11B(WT) to early/recycling endosomes but not to late endosomes ( Fig. 2A,C,E,F,I, a-a‴) [16,33]. In addition, the ATP11A(EQ), ATP11B (EQ), ATP11C(EQ), and ATP10A(EQ) mutants localized to the plasma membrane and endosomes, similarly to WT enzymes ( Fig.…”

Role of Flippases, Scramblases and Transfer Proteins in Phosphatidylserine Subcellular Distribution

“…Using a haploid human cell line mutagenized with a gene trap vector, the Nagata lab has recently identified cell populations defective in their ability to flip NBD‐PS . Two genes identified in this screen were the P4‐ATPase ATP11C and its β subunit CDC50A . ATP11C has been previously implicated in bile secretion , B‐cell development and erythrocyte PS lipid asymmetry and lifespan .…”

Alteration of transbilayer phospholipid compositions is involved in cell adhesion, cell spreading, and focal adhesion formation

“…Expression vectors for C‐terminally HA‐tagged P4‐ATPases were constructed as described previously . A cDNA fragment of the lactadherin C2 domain (LactC2) was kindly provided by Hiroyuki Arai (The University of Tokyo, Japan) and subcloned into the pEGFP vector (Clontech, Palo Alto, CA, USA) as described previously .…”