BIGHORN SHEEP (<i>OVIS CANADENSIS</i>) SINUS TUMORS ARE ASSOCIATED WITH COINFECTIONS BY POTENTIALLY PATHOGENIC BACTERIA IN THE UPPER RESPIRATORY TRACT

Fox, Karen A.; Rouse, Natalie; Huyvaert, Kathryn P.; Griffin, Karen A.; Killion, Halcyon J.; Jennings-Gaines, Jessica E.; Quackenbush, Sandra L.; Miller, Michael W.

doi:10.7589/2014-05-130

Cited by 18 publications

(19 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This pathogen does not act alone but appears to be a necessary agent for initiating epizootics. Further research is needed on the role of co‐infection by known and perhaps as yet unrecognized pathogens as well as other factors that may contribute to disease outcomes by affecting transmission, carriage, and immunity (Dassanayake et al , Besser et al , Fox et al , Wolff et al ). Clarity on the significance of these interactions will help provide a more complete understanding of the variation observed in the course of infection and disease.…”

Section: Causes Of Pneumonia In Bighorn Sheepmentioning

confidence: 99%

Pneumonia in bighorn sheep: Risk and resilience

Manlove²,

et al. 2017

View full text Add to dashboard Cite

Infectious disease contributed to historical declines and extirpations of bighorn sheep (Ovis canadensis) in North America and continues to impede population restoration and management. Reports of pneumonia outbreaks in freeranging bighorn sheep following contact with domestic sheep have been validated by the results of 13 captive commingling experiments. However, ecological and etiological complexities still hinder our understanding and control of respiratory disease in wild sheep. In this paper, we review the literature and summarize recent data to present an overview of the biology and management of pneumonia in bighorn sheep. Many factors contribute to this population-limiting disease, but a bacterium (Mycoplasma ovipneumoniae) host-specific to Caprinae and commonly carried by healthy domestic sheep and goats, appears to be a primary agent necessary for initiating epizootics. All-age epizootics are usually associated with significant population declines, but mortality rates vary widely and factors influencing disease severity are not well understood. Once introduced, M. ovipneumoniae can persist in bighorn sheep populations for decades. Carrier females may transmit the pathogen to their susceptible lambs, triggering fatal pneumonia outbreaks in nursery groups, which limit recruitment and slow or prevent population recovery. The demographic costs of disease persistence can be equal to or greater than the impacts of the initial epizootic. Strain typing suggests that spillover of M. ovipneumoniae into bighorn sheep populations from domestic small ruminants is ongoing and that consequences of spillover are amplified by movements of infected bighorn sheep across populations. Therefore, current disease management strategies focus on reducing risk of spillover from reservoir populations of domestic sheep and goats and on limiting transmission among bighorn sheep.

show abstract

Section: Causes Of Pneumonia In Bighorn Sheepmentioning

confidence: 99%

Pneumonia in bighorn sheep: Risk and resilience

Manlove²,

et al. 2017

View full text Add to dashboard Cite

show abstract

“…Although a bacterial cause for sinus tumors cannot be entirely ruled out, we suspect that bacterial infections seen in naturally occurring cases of bighorn sheep sinus tumors are a secondary process, due to decreased clearance of agents by the altered sinus lining. 3 Marked epithelial hyperplasia and rare epithelial neoplasia previously described for naturally occurring cases of bighorn sheep sinus tumors were not observed in the experimentally transmitted tumors. Epithelial proliferation was limited to mild submucosal gland hyperplasia in 2 cases, and no proliferation of surface epithelial cells was observed.…”

Section: Discussionmentioning

confidence: 87%

Experimental Transmission of Bighorn Sheep Sinus Tumors to Bighorn Sheep (Ovis canadensis canadensis) and Domestic Sheep

et al. 2016

View full text Add to dashboard Cite

Bighorn sheep sinus tumors are a recently described disease affecting the paranasal sinuses of Rocky Mountain bighorn sheep (Ovis canadensis canadensis). Several features of this disease suggest an infectious cause, although a specific etiologic agent has not been identified. To test the hypothesis that bighorn sheep sinus tumors are caused by an infectious agent, we inoculated 4 bighorn sheep lambs and 4 domestic sheep lambs intranasally with a cell-free filtrate derived from a naturally occurring bighorn sheep sinus tumor; we held 1 individual of each species as a control. Within 18 months after inoculation, all 4 inoculated domestic sheep (100%) and 1 of the 4 inoculated bighorn sheep (25%) developed tumors within the ethmoid sinuses or nasal conchae, with features similar to naturally occurring bighorn sheep sinus tumors. Neither of the uninoculated sheep developed tumors. Histologically, the experimentally transmitted tumors were composed of stellate to spindle cells embedded within a myxoid matrix, with marked bone production. Tumor cells stained positively with vimentin, S100, alpha smooth muscle actin, and osteocalcin, suggesting origin from a multipotent mesenchymal cell. A periosteal origin for these tumors is suspected. Immunohistochemical staining for the envelope protein of JSRV (with cross-reactivity to ENTV) was equivocal, and PCR assays specific for these agents were negative.

show abstract

“…Detection of M. ovipneumoniae was conducted with the real‐time PCR method as described by Ziegler et al (; TBL, WADDL, WYL) or conventional PCR as described by McAuliffe et al (; CPW, DBL, TBL, WYL) or by Weiser et al (; DBL, GWL). For detection of lktA broadly among Pasteurellaceae, participating laboratories also used several different PCR methods, including those described by Fisher et al (; GWL, TBL), Fox et al (; CPW, TBL), and Dassanayake et al (; WYL). The WADDL and TBL used a recently developed real‐time Taqman PCR procedure utilizing primers lktAF (5′‐CCGCTTATTTGGTGGTAAAGGC‐3′), lktAR (5′‐CGCCTTGACGGTGAACGAAA‐3′), and probe 5′‐FAM‐TCGATGGCGGTAAAGGCAATGACCT‐MGB‐3′, with the following cycling parameters: 1) hold 50° C, 2 min; 2) hold 95° C, 600 s; 3) 38 cycles of denaturation (95° C, 15 s) and annealing–extension (61° C, 60 s).…”

Section: Methodsmentioning

confidence: 99%

Concordance in diagnostic testing for respiratory pathogens of bighorn sheep

et al. 2016

Self Cite

View full text Add to dashboard Cite

Reliable diagnostic tests are essential for disease investigation and management. This is particularly true for diseases of free-ranging wildlife where sampling is logistically difficult precluding retesting. Clinical assays for wildlife diseases frequently vary among laboratories because of lack of appropriate standardized commercial kits. Results of diagnostic testing may also be called into question when investigators report different etiologies for disease outbreaks, despite similar clinical and pathologic findings. To evaluate reliability of diagnostic testing for respiratory pathogens of bighorn sheep (Ovis canadensis), we conducted a series of ring tests across 6 laboratories routinely involved in detection of Mycoplasma ovipneumoniae, Pasteurellaceae, lktA (the Pasteurellaceae gene encoding leukotoxin), and 3 reference laboratories. Consistency of results for replicate samples within laboratories was high (median agreement ¼ 1.0). Agreement between laboratories was high for polymerase chain reaction (PCR) detection of M. ovipneumoniae and culture isolation of Mannheimia spp. and Bibersteinia trehalosi (median agreement ¼ 0.89-0.95, Kappa ¼ 0.65-0.74), and lower for PCR detection of Mannheimia spp. lktA (median agreement ¼ 0.58, Kappa ¼ 0.12). Most errors on defined status samples were false negatives, suggesting test sensitivity was a greater problem than specificity. However, tests for M. haemolytica and lktA yielded some false positive results. Despite differences in testing protocols, median agreement among laboratories and correct classification of controls for most agents was !0.80, meeting or exceeding the standard required by federal proficiency testing programs. This information is valuable for interpreting test results, laboratory quality assessments, and advancing diagnosis of respiratory disease in wild sheep. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

show abstract

BIGHORN SHEEP (OVIS CANADENSIS) SINUS TUMORS ARE ASSOCIATED WITH COINFECTIONS BY POTENTIALLY PATHOGENIC BACTERIA IN THE UPPER RESPIRATORY TRACT

Cited by 18 publications

References 19 publications

Pneumonia in bighorn sheep: Risk and resilience

Pneumonia in bighorn sheep: Risk and resilience

Experimental Transmission of Bighorn Sheep Sinus Tumors to Bighorn Sheep (Ovis canadensis canadensis) and Domestic Sheep

Concordance in diagnostic testing for respiratory pathogens of bighorn sheep

Contact Info

Product

Resources

About