BMI1 Polycomb Group Protein Acts as a Master Switch for Growth and Death of Tumor Cells: Regulates TCF4-Transcriptional Factor-Induced BCL2 Signaling

Siddique, Hifzur R.; Parray, Aijaz; Tarapore, Rohinton; Wang, Lei; Mukhtar, Hasan; Karnes, R.J.; Deng, Yibin; Konety, Badrinath R.; Saleem, Mohammad

doi:10.1371/journal.pone.0060664

Cited by 33 publications

(39 citation statements)

References 42 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…BMI1, which is essential for the self-renewal of normal and malignant stem cells, is another important gene that induces MDR. The mechanism of action of BMI1 may be related to antioxidation and the upregulation of bcl-2, resulting in resistance to chemotherapy-induced apoptosis (26,27). Downregulation of BMI1 may increase drug-induced tumor cell apoptosis, thus enhancing sensitivity to chemotherapy (28).…”

Section: Discussionmentioning

confidence: 99%

Mda-7/IL-24 enhances sensitivity of B cell lymphoma to chemotherapy drugs

Zhao

Sun

et al. 2016

Oncology Reports

View full text Add to dashboard Cite

Abstract. ) is a cytokine encoded by a tumor suppressor gene of the IL-10 family, also known as the melanoma differentiation associated gene-7 (Mda-7) and first discovered in human melanoma cells. Mda-7/IL-24 has been shown to inhibit the proliferation of various human tumor cell lines, but its effect on the sensitivity of B cell lymphoma to chemotherapy agents is not yet clear. The present study investigated the effects of Mda-7/IL-24 overexpression on the sensitivity of human B cell lymphoma cells to chemotherapy, as well as its mechanism of action. The sensitivity of stable Mda-7/IL-24 overexpressing Raji and Daudi cells to cis-diamminedichloroplatinum (CDDP), epirubicin and vinblastine (VCR) were assessed by the MTS method, and the IC 50 value calculated. Cell apoptosis and the intracellular accumulation of Rhodamine-123 were assayed by flow cytometry. The expression of multidrug resistance gene 1 (MDR1), B-cell-specific Moloney murine leukemia virus insertion site 1 (BMI1), topoisomerase II (Topo II) and multidrug resistance-related protein 1 (MRP1) mRNA and protein were analyzed by reverse transcription quantitative polymerase chain reaction (RT-qPCR) and western blotting, respectively. In addition, western blot analysis was also used to investigate the effect of Mda-7/IL-24 on activity of GTP-RhoA-ERK signaling pathway in Raji and Daudi cells. Growth inhibition and apoptosis rates of Mda-7/IL-24 overexpressing Raji and Daudi cells were higher than those of non-transfected cells and cells transfected with vector alone when treated with CDDP, epirubicin and VCR. The IC 50 values of CDDP, epirubicin and VCR were lower for Mda-7/IL-24-overexpressing Raji and Daudi cells than for non-transfected cells and cells transfected with empty vector. Intracellular accumulation of Rhodamine-123 and the expression of Topo II were higher, while the levels of MDR1, BMI and MRP1 mRNA and protein were lower, in Mda-7/IL-24 overexpressing Raji and Daudi cells. Furthermore, the activities of GTP-RhoA-ERK signaling pathway in Raji and Daudi cells were suppressed. These results indicated that Mda-7/IL-24 enhanced the sensitivity of B lymphoma cells to chemotherapy agents by altering the expression of multidrug-resistance genes via downregulating GTP-RhoA-ERK signaling pathway, suggesting that treatment of B cell lymphomas with Mda-7/IL-24 could avoid MDR.

show abstract

Section: Discussionmentioning

confidence: 99%

Mda-7/IL-24 enhances sensitivity of B cell lymphoma to chemotherapy drugs

Zhao

Sun

et al. 2016

Oncology Reports

View full text Add to dashboard Cite

show abstract

“…Following primers were used for ROBO1: Forward , 5'‐gcatcgctggaagtagccatact −3'; Reverse , 5'‐ ctagaaatggtgggctcaggat 3'. A constitutively expressed GAPDH was used as internal control . PCR conditions were as follows: one cycle of initial annealing temperature of 94 °C for 3 min followed by 40 cycles of 94°C for 15 sec, 63°C for 15 sec, and an elongation phase of 72°C for 30 sec.…”

Section: Methodsmentioning

confidence: 99%

“…Immunoflorescence‐confocal microscopy in tissues and cells was performed by the methods as described earlier . For in vitro assay, cells seeded in chamber slides were grown in presence of recombinant Slit‐2 (rSlit‐2) protein.…”

Section: Methodsmentioning

confidence: 99%

“…For in vitro assay, cells seeded in chamber slides were grown in presence of recombinant Slit‐2 (rSlit‐2) protein. At 48 hr post‐transfection, cells were fixed and immunostained with primary antibodies (anti‐ROBO1; anti‐Rac1‐GTP, anti‐DOCK1) at 1:200 dilution by the method as described . Cy anti‐mouse (ROBO1), Alexa‐Fluor 488 anti‐mouse (ROBO1& Rac‐GTP) and Alexa‐Fluor 488 anti‐rabbit (DOCK1) were used as secondary antibodies.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

ROBO1, a tumor suppressor and critical molecular barrier for localized tumor cells to acquire invasive phenotype: Study in African‐American and Caucasian prostate cancer models

Parray

Siddique

Kuriger

et al. 2014

Intl Journal of Cancer

Self Cite

View full text Add to dashboard Cite

High-risk populations exhibit early transformation of localized prostate cancer (CaP) disease to metastasis which results in the mortality of such patients. The paucity of knowledge about the molecular mechanism involved in acquiring of metastatic behavior by primary tumor cells and non-availability of reliable phenotype-discriminating biomarkers are stumbling blocks in the management of CaP disease. Here, we determine the role and translational relevance of ROBO1 (an organogenesis-associated gene) in human CaP. Employing CaP-progression models and prostatic tissues of Caucasian and African-American patients, we show that ROBO1 expression is localized to cell-membrane and significantly lost in primary and metastatic tumors. While Caucasians exhibited similar ROBO1 levels in primary and metastatic phenotype, a significant difference was observed between tumor phenotypes in African-Americans. Epigenetic assays identified promoter methylation of ROBO1 specific to African-American metastatic CaP cells. Using African-American CaP models for further studies, we show that ROBO1 negatively regulates motility and invasiveness of primary CaP cells, and its loss causes these cells to acquire invasive trait. To understand the underlying mechanism, we employed ROBO1-expressing/ROBO1-C2C3-mutant constructs, immunoprecipitation, confocal-microscopy and luciferase-reporter techniques. We show that ROBO1 through its interaction with DOCK1 (at SH3-SH2-domain) controls the Rac-activation. However, loss of ROBO1 results in Rac1-activation which in turn causes E-Cadherin/β-catenin cytoskeleton destabilization and induction of cell migration. We suggest that ROBO1 is a predictive biomarker that has potential to discriminate among CaP types, and could be exploited as a molecular target to inhibit the progression of disease as well as treat metastasis in high-risk populations such as African-Americans.

show abstract

“…Moreover, Bmi1 has been reported to confer anti-apoptotic ability and chemoresistance to cancer cells. [15, 16]. The abnormal expression of Bmi1 has been also reported to link disease progression and poor prognosis in pancreatic cancer patients [17].…”

Section: Introductionmentioning

confidence: 99%

Bmi1 inhibition enhances the sensitivity of pancreatic cancer cells to gemcitabine

et al. 2016

View full text Add to dashboard Cite

As the standard therapy for pancreatic cancer, gemcitabine shows limited efficacy in pancreatic cancer patients because of chemoresistance. Aberrant expression of Bmi1 has been reported to activate multiple growth-regulatory pathways and confer anti-apoptotic abilities to many cancer cells. However, the role of Bmi1 in response of pancreatic cancer cells towards gemcitabine resistance remains elusive. In this study, we found that certain dose of gemcitabine treatment induced Bmi1 expression in pancreatic cancer cells. Knockdown of Bmi1 enhanced ROS production and promoted the cytotoxic effect of gemcitabine. The increased oxidative stress upon gemcitabine treatment could disrupt mitochondrial membrane and decrease mitochondrial membrane potential, eventually leading to apoptosis. Bmi1 inhibition also suppressed the activation of NF-κB signaling and the expressions of downstream molecules in pancreatic cancer cells treated with gemcitabine. Moreover, we observed Bmi1 inhibition sensitized the pancreatic xenograft tumors to gemcitabine in vivo. Taken together, our study demonstrated that Bmi1 could decrease the sensitivity of pancreatic cancer cells to gemcitabine through increasing oxidative stress and inhibiting NF-κB signaling, thus Bmi1 may serve as a promising target for sensitizing pancreatic cancer cells to chemotherapy.

show abstract

BMI1 Polycomb Group Protein Acts as a Master Switch for Growth and Death of Tumor Cells: Regulates TCF4-Transcriptional Factor-Induced BCL2 Signaling

Cited by 33 publications

References 42 publications

Mda-7/IL-24 enhances sensitivity of B cell lymphoma to chemotherapy drugs

Mda-7/IL-24 enhances sensitivity of B cell lymphoma to chemotherapy drugs

ROBO1, a tumor suppressor and critical molecular barrier for localized tumor cells to acquire invasive phenotype: Study in African‐American and Caucasian prostate cancer models

Bmi1 inhibition enhances the sensitivity of pancreatic cancer cells to gemcitabine

Contact Info

Product

Resources

About