Broadly neutralizing plasma antibodies effective against diverse autologous circulating viruses in infants with multivariant HIV-1 infection

Abstract

1 0 Due to the extensive antigenic diversity of HIV-1, broadly neutralizing antibodies (bnAbs) develop in a 1 1 subset of infected individuals over 2-3 years of infection 1,2 . Interestingly, infected infants have been 1 2 shown to develop plasma bnAbs frequently and as early as one-year post-infection 3 , with features 1 3 atypical than adult bnAbs 4,5 , suggesting the factors governing bnAb induction in infants are different 1 4 than those in adults. Understanding the antigenic features in infants with early bnAb responses will 1 5 provide key information on the antigenic triggers driving B cell maturation pathways towards induction 1 6 of bnAbs. Herein, we evaluated the presence of plasma bnAbs in HIV-1 clade C perinatally infected 1 7 infants of Indian origin and identified the viral factors associated with early bnAb responses. A strong 1 8 association of multivariant infection in infant elite neutralizers with development of plasma nAbs 1 9

A rare mutation in an infant derived HIV-1 envelope glycoprotein alters interprotomer stability and susceptibility to broadly neutralizing antibodies targeting the trimer apex

“…On the basis of plasma neutralization data against difficult-to-neutralize (Tier 2/3) Global Panel of HIV-1 isolates and epitope mapping done using single base mutants in 25710_2_43, 16055_2_3 and CAP45_G3 and BG505.W6M.C2 pseudoviral backbones (29), an HIV-1 infected infant AIIMS731 was previously categorized as a broad neutralizer with plasma bnAbs targeting the N160-glycan in the V2-apex of HIV-1 Env ( Figure 1A – C ).…”

“…In order to evaluate the viral population dynamics associated with the presence of V2-apex plasma bnAbs in this infant broad neutralizer, first, we cloned functional Env genes from the plasma RNA via single genome amplification (SGA), and assessed their susceptibility to autologous plasma bnAbs. A total of 40 Env gene sequences (clade C) from AIIMS731 were available (29), and the depth of SGA sequencing gave us a 90% confidence interval of identifying circulating variants present at a population frequency of 5%. Based on sequence identity, the SGA sequences represented the six dominant R5-tropic circulating strains in AIIMS731 plasma, and were highly homogenous, with sequence variability between the clones ranging from 0.1 to 0.4% ( Figure 2A – C ).…”

“…Autologous replication incompetent envelope pseudoviruses were generated from AIIMS731 as described previously (29, 37). Briefly, viral RNA was isolated from 140 µl of plasma using QIAamp Viral RNA Mini Kit, reverse transcribed, using gene specific primer OFM19 (5’ - GCACTCAAGGCAAGCTTTATTGAGGCTTA – 3’) and Superscript III reverse transcriptase, into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs).…”

“…In a recently reported cohort of HIV-1 infected infants with an early plasma bnAb response targeting the Envelope glycoprotein, we had identified a 9-month old infant, AIIMS731, whose plasma bnAbs showed maximum dependence on the V2-apex with 75% breadth at a geometric mean titre (GMT) of 130 against the standardized 12-virus global panel representing global viral diversity (29). In order to understand the virus-antibody dynamics in the context of neutralizing determinants within the V2-apex and early induction of V2-apex targeting plasm bnAbs, herein we studied the viral features associated with escape from plasma bnAbs in an infant broad neutralizer AIIMS731.…”

A versatile high throughput strategy for cloning the env gene of HIV-1

“…To overcome this, we next performed nested PCR using all of the possible primer pair combinations (a total of 576 individual PCR reactions), Four of these primer pairs yielded a prominent env/rev amplification from 8 HIV-1 infected samples ( Fig. 2e ), randomly selected from a recent cohort of HIV-1 infected infants (45). Despite employing optimized primers selected from an exhaustive panel, the cloning efficiency of the env/rev cassettes via SGA amplification varied between samples.…”