Characterization of insertion sequence IS892 and related elements from the cyanobacterium Anabaena sp. strain PCC 7120

Abstract

IS892, one of the several insertion sequence (IS) elements discovered in Anabaena sp. strain PCC 7120 (Y. Cai and C. P. Wolk, J. Bacteriol. 172:3138-3145, 1990), is 1,675 bp with 24-bp near-perfect inverted terminal repeats and has two open reading frames (ORFs) that could code for proteins of 233 and 137 amino acids. Upon insertion into target sites, this IS generates an 8-bp directly repeated target duplication. A 32-bp sequence in the region between ORF1 and ORF2 is similar to the sequence of the inverted ternmini. Similar inverted repeats are found within each of those three segments, and the sequences of these repeats bear some similarity to the 11-bp direct repeats flanking the 11-kb insertion interrupting the nifD gene of this strain (J. W. Golden, S. J. Robinson, and R. Haselkorn, Nature [London] 314:419-423, 1985). A sequence similar to that of a binding site for the Escherichia coli integration host factor is found about 120 bp from the left end of IS892. Partial nucleotide sequences of active IS elements IS892N and IS892T, members of the IS892 family from the same Anabaena strain, were shown to be very similar to the sequence of IS892.Insertion sequences (IS) are transposable elements that are generally smaller than transposons and normally bear only genes related to transposition (for a review, see reference 12). Because IS elements lack selectable markers, they are usually identified by their ability to introduce insertional mutations in marker genes and operons (9, 14). Most IS elements from a variety of prokaryotes are 0.8 to 2.5 kb in size and have a pair of near-perfect inverted terminal repeats ranging from 8 to 41 bp. Almost all bacterial IS elements characterized to date generate directly repeated duplications of their target DNA sequences upon insertion. Many elements make a duplication of a fixed number of base pairs, ranging from 2 to 13 bp, as a characteristic of the element (12).Cyanobacteria (blue-green algae) are prokaryotes that differ physiologically and phylogenetically (43) from other eubacteria. Two active IS elements have been isolated and sequenced from cyanobacteria: IS701 from Calothrix sp. strain PCC 7601 (12, 27) and IS891 from Anabaena sp. strain M-131 (4). IS701 appears to be a typical IS element with inverted terminal repeats and the generation of target duplications (27). By contrast, IS891 lacks inverted terminal repeats and fails to generate a target duplication upon insertion (4). In addition, genetic elements, collectively denoted the mys family, from the cyanobacterium Anabaena sp. strain PCC 7120 were suggested to be IS on the basis of the structural similarity of their nucleotide sequence to that of typical IS elements (1).In a study of spontaneous mutation of the conditionally lethal gene sacB in Anabaena sp. strain PCC 7120, 10 IS elements of five different sizes were detected and one of them, IS892, was restriction mapped (7). I report here a more detailed study of IS892 and of related IS elements in this Anabaena strain. MATERIALS AND METHODSBacterial strains,...

Characterization of transposon Tn5469 from the cyanobacterium Fremyella diplosiphon

“…Of the two, IS702 appeared to be the most dispersed; sequences homologous to IS702 were detected in heterocystous, nonheterocystous, and even unicellular forms. The distribution of IS892 (8) and IS895 (1) from Anabaena sp. strain PCC 7120 is also limited; sequences homologous to IS892 and IS895 were found in closely related filamentous species but not in several unicellular genera.…”

“…For all strains, cells from a 50-ml culture were harvested by centrifugation at 16,000 ϫ g for 10 min at 4ЊC, washed by resuspension in 30 ml of ice-cold lysis buffer (50 mM glucose, 25 mM Tris-HCl [pH 8.0], 10 mM EDTA), and reharvested. The cell pellet was resuspended in 2 ml of lysis buffer, and the suspension was frozen in liquid nitrogen.…”

Cyanobacterial Two-Component Proteins: Structure,Diversity, Distribution, andEvolution

“…In Anabaena sp. strain PCC 7120, a total of 145 genes were identified as presumptively encoding transposases, with 86 in the chromosome and the remaining 59 in the plasmids (63), and frequent transposition of IS892 was observed during prolonged culture (25). On the other hand, the four ISs specific for the Synechocystis Kazusa strain probably result from recent transposition events (103).…”

Characterization of the IS895 family of insertion sequences from the cyanobacterium Anabaena sp. strain PCC 7120

“…AGTGGATATTTGAGTGGTTTATTAGACACACTACCTTTGATTTTGACACTCTACAGATGTACGi C AAATTAGGATCCATA the cyanobacterial IS elements IS891 (2) or IS892 (6) or to other sequences in the GenBank data base. Although regions of similarity have been noted in certain IS elements (23), many others are dissimilar in both sequence and organization (12).…”

“…strain PCC 7120 (7). The element IS892 and related elements from this organism have recently been characterized and are described by Cai (6). We report here the characterization of the IS895 family of insertion sequences from Anabaena sp.…”