Characterization of whole genome radiation hybrid mapping resources for non-mammalian vertebrates

Kwok, Cheni; Korn, Richard M.; Davis, Maria E.; Burt, David W.; Critcher, Ricky; McCarthy, Linda; Paw, Barry H.; Zon, Leonard I.; Goodfellow, Peter N.; Schmitt, Karin

doi:10.1093/nar/26.15.3562

Cited by 108 publications

(75 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We determined the chromosomal positions of zebrafish D2 and D3 receptor genes by using the T51 radiation hybrid panel (Kwok et al, 1998). Gene map positions were calculated with the Zon RH mapper resource (http://zfrhmaps.tch.harvard.…”

Section: Chromosomal Mapping Of Zebrafish D2 and D3 Receptor Genesmentioning

confidence: 99%

See 1 more Smart Citation

Evolution and expression of D2 and D3 dopamine receptor genes in zebrafish

Boehmler

Obrecht-Pflumio

Canfield

et al. 2004

Developmental Dynamics

146

122

View full text Add to dashboard Cite

We mined the zebrafish genomic sequence database and identified contigs containing segments of several dopamine receptor genes. By using a polymerase chain reaction amplification strategy, we generated full-length cDNAs encoding a single dopamine D3 receptor and three distinct D2 receptor subtypes. Zebrafish dopamine receptor genes were mapped by using the T51 radiation hybrid panel. The D3 receptor gene (drd3) mapped to linkage group (LG) 24. The three D2 receptor genes were localized to LG 15 (drd2a), LG 16, (drd2b), and LG 5 (drd2c). With the exception of the drd2b gene, each of these map positions was syntenic with regions of human chromosomes containing orthologs of the zebrafish dopamine receptor genes. Whole-mount in situ hybridization was used to investigate expression of the D2 and D3 receptor genes. Expression of the drd3 gene was first detected at mid-somitogenesis and was particularly prominent in somites. Thereafter, the drd3 gene was expressed diffusely throughout the brain and spinal cord. The three D2 receptor genes were expressed throughout the central nervous system (CNS) in distinct but overlapping patterns. In early embryos, the drd2a gene was expressed exclusively in the epiphysis, whereas the drd2c gene was localized to the notochord. After 24 hpf, the drd2a, drd2b, and drd2c genes were differentially expressed throughout the CNS. The identification of dopamine receptor genes in zebrafish should allow us to use the power of zebrafish genetics to analyze the functional properties of this important class of neurotransmitter receptors.

show abstract

Section: Chromosomal Mapping Of Zebrafish D2 and D3 Receptor Genesmentioning

confidence: 99%

“…Zebrafish dopamine receptor genes were mapped by using the Goodfellow T51 radiation hybrid (RH) panel (Kwok et al, 1998). The T51 panel was purchased from Research Genetics and made available to us by Dr. Keith Cheng (Department of Pathology, Penn State College of Medicine).…”

Section: Chromosomal Mapping Of Zebrafish Dopamine Receptor Genesmentioning

confidence: 99%

Evolution and expression of D2 and D3 dopamine receptor genes in zebrafish

Boehmler

Obrecht-Pflumio

Canfield

et al. 2004

Developmental Dynamics

146

122

View full text Add to dashboard Cite

show abstract

“…This map position is flanked by microsatellite markers z4760, z3334, and z1390 at 85.1 cM and z9871 at 93.7 cM. We attempted to confirm this linkage assignment by mapping atp1b2b on the T51 radiation hybrid (RH) panel (Kwok et al, 1998). We found that atp1b2b had an identical RH type to microsatellite marker z8122.…”

Section: Resultsmentioning

confidence: 94%

Two Na,K-ATPase β2 subunit isoforms are differentially expressed within the central nervous system and sensory organs during zebrafish embryogenesis

Rajarao¹,

Canfield²,

Loppin³

et al. 2002

Dev. Dyn.

View full text Add to dashboard Cite

We have identified cDNAs encoding a second zebrafish ortholog of the human Na,K-ATPase ␤2 subunit. The ␤2b cDNA encodes a 292 amino acid-long polypeptide with 74% identity to the previously characterized zebrafish ␤2a subunit. By using a zebrafish meiotic mapping panel, we determined that the ␤2b gene (atp1b2b) was tightly linked to markers on linkage group 5, whereas the ␤2a gene was located on linkage group 23. In situ hybridization analysis shows that in developing zebrafish embryos, atp1b2a and atp1b2b are predominantly expressed in the nervous system. ␤2a transcripts were abundantly expressed throughout brain as well as spinal cord neurons and lateral line ganglia. In contrast, ␤2b mRNA expression was primarily detected in sensory organs, including retina, otic vesicles, and lateral line neuromast cells. These results suggest that the ␤2a and ␤2b genes play distinct roles in developing brain and sensory organs, and raise the possibility that the functions encoded by the single mammalian ␤2 gene may be partitioned between the two zebrafish ␤2 orthologs.

show abstract

“…By using the T51 zebrafish-hamster somatic cell radiation hybrid (RH) panel (Kwok et al, 1998), zath3 was mapped to ϳ34 cM from the top of the linkage group (LG) 23 (Fig. 1C).…”

Section: Resultsmentioning

confidence: 99%

“…T51 radiation hybrid panel (zebrafishhamster hybrid cell lines; Research Genetics; Kwok et al, 1998;Geisler et al, 1999) was used to map zath3. The following two primers were used (M1: 5Ј TCTGTATACTCTTGATGTCC 3Ј; M2: 5Ј ACTTTATGAGAATCGGTAGC 3Ј).…”

Section: Genome Mappingmentioning

confidence: 99%

Zebrafish atonal homologue zath3 is expressed during neurogenesis in embryonic development

Wang

Emelyanov

Korzh

et al. 2003

Developmental Dynamics

View full text Add to dashboard Cite

Basic helix-loop-helix (bHLH) transcriptional activators function in development of various cell lineages, including the central nervous system. One of the bHLH proteins, Math3/Xath3/NeuroM, was suggested to act as a late proneural gene in the mouse, Xenopus, and chick. Here, we isolated a zebrafish homologue, named zath3, and analyzed its expression pattern in zebrafish embryos. In the neural plate, zath3 is expressed first in the primordia of the tegmentum and trigeminal ganglia and three classes of primary neurons: sensory neurons, interneurons, and motor neurons. During later development, zath3 transcripts were localized along the boundaries of the optic tectum in the midbrain and rhombomeres of the hindbrain. Analyses of zath3 expression in three mid-hindbrain boundary mutants, acerebellar, no isthmus, and spiel-ohne-grensen, indicated that distribution of zath3 mRNAs in the midbrain and hindbrain was dramatically disturbed. In addition, these mutants also affect expression of zath3 in the neuroretina.

show abstract

Characterization of whole genome radiation hybrid mapping resources for non-mammalian vertebrates

Cited by 108 publications

References 24 publications

Evolution and expression of D2 and D3 dopamine receptor genes in zebrafish

Evolution and expression of D2 and D3 dopamine receptor genes in zebrafish

Two Na,K-ATPase β2 subunit isoforms are differentially expressed within the central nervous system and sensory organs during zebrafish embryogenesis

Zebrafish atonal homologue zath3 is expressed during neurogenesis in embryonic development

Contact Info

Product

Resources

About