Characterizing the Human Mycobiota: A Comparison of Small Subunit rRNA, ITS1, ITS2, and Large Subunit rRNA Genomic Targets

Abstract

Interest in the human microbiome has increased dramatically in the last decade. However, much of this research has focused on bacteria, while the composition and roles of their fungal counterparts remain less understood. Furthermore, a variety of methodological approaches have been applied, and the comparability between studies is unclear. This study compared four primer pairs targeting the small subunit (SSU) rRNA (18S), ITS1, ITS2, and large subunit (LSU) rRNA (26S) genomic regions for their ability to accurately characterize fungal communities typical of the human mycobiota. All four target regions of 21 individual fungal mock community taxa were capable of being amplified adequately and sequenced. Mixed mock community analyses revealed marked variability in the ability of each primer pair to accurately characterize a complex community. ITS target regions outperformed LSU and SSU. Of the ITS regions, ITS1 failed to generate sequences for Yarrowia lipolytica and all three Malassezia species when in a mixed community. These findings were further supported in studies of human sinonasal and mouse fecal samples. Based on these analyses, previous studies using ITS1, SSU, or LSU markers may omit key taxa that are identified by the ITS2 marker. Of methods commonly used in human mycobiota studies to date, we recommend selection of the ITS2 marker. Further investigation of more recently developed fungal primer options will be essential to ultimately determine the optimal methodological approach by which future human mycobiota studies ought to be standardized.

Impact of ITS-Based Sequencing on Antifungal Treatment of Patients with Suspected Invasive Fungal Infections

“…Based on the data presented, ITS-sequencing has been established at our center as a routine investigation in addition to all the other diagnostic tools, like culture, biomarker testing including recently released Aspergillus lateral flow device tests and PCRs. In some studies, the sequencing of amplicons of 18S or ITS2 genes outperformed the results created by using ITS1 targets, as used in our study [34,35].…”

The Human Lung Mycobiome in Chronic Respiratory Disease: Limitations of Methods and Our Current Understanding

“…Nevertheless, these targets are commonly used in the literature (see Table 1), particularly ITS1, which was suggested as the universal barcoding target for fungi [82]. A few studies have analysed the accuracy of ITS1 sequencing using mock communities and found significant bias for some groups [81,83,84]. Variation in amplicon size may contribute to such bias, as the commonly used ITS1 amplicon is known to contain an intron in some fungi.…”

“…Hoggard et al assessed the use of four amplicon targets (ITS1, ITS2, SSU and LSU) with mock communities consisting of known members of the human mycobiota [83]. This analysis found an overrepresentation of Candida albicans and Trichosporon dermatis with all targets.…”

“…However, although often curated, they can be incomplete and contain inconsistencies due to taxonomic reassignments. For example, analysing mock communities using ITS1 resulted in over 15% of sequences being assigned as 'unclassified' when using the UNITE database [83]. In addition, 85% of taxa within UNITE belong to the Dikarya, causing a bias toward this sub-kingdom when performing the taxonomic assignment of mycobiome data [18].…”

Soil Fungal Communities Investigated by Metabarcoding within Simulated Forensic Burial Contexts

“…(GCTGCGTTCTTCATCGATGC) primers for ITS1 [36] and forward fITS9 (GAACGCAGCRAAIIGYGA) and reverse ITS4 (TCCTCCGCTTATTGATATGC) primers (Sigma-Aldrich, U.K.) for ITS2 ( [37], [38] respectively) were used in combination with 8 bp unique tags (Supporting Table S2). The expected amplicon size was ~ 250-600 bp for ITS1 [39,40] and ~ 240-460 for ITS2. Primers and tags used for the subsequent analyses both for ITS1 and for ITS2 amplifications have been listed in Supporting Table S2.…”