Cloning, Structural Organization and Chromosomal Mapping of Rat Costimulatory Molecule 4-1BBL

Abstract

4-1BBL (TNFSF9) is a member of the tumor necrosis factor (TNF) ligand superfamily, which is expressed on some activated antigen presenting cells and B cells. We isolated a rat cDNA clone encoding the rat homologue of the human 4-1BBL (GenBank accession No. AY259541). The deduced rat 4-1BBL protein, consisting of 308 amino acids with a molecular weight of 33,469 Da, was a typical type II transmembrane glycoprotein, the same as human and murine 4-1BBL. "SDAA" in the cytoplasmic domain of rat 4-1BBL was deduced to act as the phosphorylation site for casein kinase I ("SXXS" motif), which is present in the cytoplasmic domains of human and murine 4-1BBL, and all other TNF ligand family members known to utilize reverse signaling. The two introns of 4-1BBL were also cloned (GenBank accession No. AY332409). Rat 4-1BBL is much more homologous with murine 4-1BBL than with human 4-1BBL, in both nucleotide and amino acid sequences. Rat 4-1BBL was expressed in all tested tissues: brain, lung, colon, liver, thymus, testicle, kidney, adrenal, stomach, spleen and heart. The chromosomal location of rat 4-1BBL was first identified by bioinformatics, then by fluorescence in situ hybridization at 9q11 (GenBank accession UniGene No. Rn.46783). Rat, murine and human 4-1BBL genes are evolved from a common gene. The identification and characterization of the rat counterpart of human 4-1BBL will facilitate studies of the biological function of this molecule.

Characterization and application of three novel monoclonal antibodies against human 4‐1BB: distinct epitopes of human 4‐1BB on lung tumor cells and immune cells

“…Total RNA was isolated from 1 × 10 6 cells lysed with TRIZOL reagents (Takara, Dalian, China). RT‐PCR was performed as described (28). Primer sequences were as follows: 4‐1BB‐A, 5′‐CTCCTGCAGATGGGAAACAGCTGTTAC‐3′; 4‐1BB‐B, 5′‐CTCGAATTCTCACAGTTCACATCCTC‐3′.…”