Colletotrichum echinochloae, a new species on Japanese barnyard millet (Echinochloa utilis)

Moriwaki, Jouji; Tsukiboshi, Takao

doi:10.1007/s10267-009-0485-1

Cited by 26 publications

(14 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…(2012) Col. duyunensis CGMCC 3.15105 T JX625160KC843515––KC843530JX625187–––Tao et al. (2013) Col. echinochloae MAFF 511473 T AB439811–––––––AB440153Moriwaki & Tsukiboshi (2009), Col. eleusines MAFF 511155 T EU554131, JX519218–JX519226–JX519234JX519243EU365038–EU554234Cannon et al., 2012, Crouch et al., 2009b, Crouch et al., 2009c, Col. endophytum CGMCC 3.15108 T JX625177KC843521––KC843533JX625206–––Tao et al. (2013) Col. eremochloae CBS 129661 T JQ478447, JX519220–JX519228–JX519236JX519245JQ478476JQ478462JQ478449Cannon et al., 2012, Crouch and Tomaso-Peterson, 2012 Col. falcatum CBS 147945 T HM171877, JQ005772HM171677, JQ005793JQ005814JQ005835…”

Section: Resultsmentioning

confidence: 99%

Genera of phytopathogenic fungi: GOPHY 1

Marín-Felix

Groenewald

Cai

et al. 2017

Studies in Mycology

331

263

View full text Add to dashboard Cite

Genera of Phytopathogenic Fungi (GOPHY) is introduced as a new series of publications in order to provide a stable platform for the taxonomy of phytopathogenic fungi. This first paper focuses on 21 genera of phytopathogenic fungi: Bipolaris, Boeremia, Calonectria, Ceratocystis, Cladosporium, Colletotrichum, Coniella, Curvularia, Monilinia, Neofabraea, Neofusicoccum, Pilidium, Pleiochaeta, Plenodomus, Protostegia, Pseudopyricularia, Puccinia, Saccharata, Thyrostroma, Venturia and Wilsonomyces. For each genus, a morphological description and information about its pathology, distribution, hosts and disease symptoms are provided. In addition, this information is linked to primary and secondary DNA barcodes of the presently accepted species, and relevant literature. Moreover, several novelties are introduced, i.e. new genera, species and combinations, and neo-, lecto- and epitypes designated to provide a stable taxonomy. This first paper includes one new genus, 26 new species, ten new combinations, and four typifications of older names.

show abstract

Section: Resultsmentioning

confidence: 99%

Genera of phytopathogenic fungi: GOPHY 1

Marín-Felix

Groenewald

Cai

et al. 2017

Studies in Mycology

331

263

View full text Add to dashboard Cite

show abstract

“…Although ITS sequence data may help in Colletotrichum species identification, it cannot alone be used to adequately address species delimitation for closely related species [10]. Researchers have recently tried to examine multiple genes sequence data to distinguish species in Colletotrichum [10,[11][12][13][14][15][16].…”

Section: Introductionmentioning

confidence: 99%

A Species-Specific PCR Based Assay for Rapid Detection of Mango Anthracnose Pathogen Colletotrichum gloeosporioides Penz. and Sacc

Kamle¹

2013

J Plant Pathol Microb

View full text Add to dashboard Cite

Mango (Mangifera indica L.) a fruit of nutraceutical value is accepted as the most eatable fruit crop worldwide. Mango production has been severely affected by several biotic stress mainly diseases and anthracnose is the major post-harvest disease of mango results in heavy losses. The present investigation describes PCR based assay for rapid and sensitive detection of Colletotrichum gloeosporioides causing mango anthracnose. Genus specific universal primer pair ITS1 and ITS4 was employed to amplify Colletotrichum genus which shows ‫065ﮧ‬ bp amplicon. The Colletotrichum gloeosporioides species-specific sequences for conserved domains were retrieved from the NCBI Genbank (sequence HM10205) and specific primers were designed. In order to validate the speciesspecific designed primer, a sensitive nested PCR assay was carried out using designed primer-pair MKCgF 5` TTGCTTCGGCGGGTAGGGTC 3` (forward) and MKCgR 3`ACGCAAAGGAGGCTCCGGGA 5` (reverse) produced an amplicon size of 380 bp as specific. Our investigation revealed that C. gloeosporioides causal agent of mango anthracnose was discriminated on the basis of species as specific for mango in comparison to other Colletotrichum spp. viz. C. acutatum, C. falcatum and C. capsici causing anthracnose in other crops.

show abstract

“…460 bp of the 28S rDNA D1-D2 were selected. Methods for DNA extraction, amplification, sequencing and phylogenetic analysis followed Moriwaki and Tsukiboshi (2009). Regions of the 28S rDNA D1-D2 were amplified by PCR using the primer pairs of NL1 and NL4 (O'Donnell 1993).…”

mentioning

confidence: 99%