Color Vision Variation as Evidenced by Hybrid L/M Opsin Genes in Wild Populations of Trichromatic Alouatta New World Monkeys

Abstract

Platyrrhine (New World) monkeys possess highly polymorphic color vision owing to allelic variation of the single-locus L/M opsin gene on the X chromosome. Most species consist of female trichromats and female and male dichromats. Howlers (genus Alouatta) are an exception; they are considered to be routinely trichromatic with L and M opsin genes juxtaposed on the X chromosome, as seen in catarrhine primates (Old World monkeys, apes, and humans). Yet it is not known whether trichromacy is invariable in howlers. We examined L/M opsin variation in wild howler populations in Costa Rica and Nicaragua (Alouatta palliata) and Belize (A. pigra), using fecal DNA. We surveyed exon 5 sequences (containing the diagnostic 277th and 285th residues for λmax) for 8 and 18 X chromosomes from Alouatta palliata and A. pigra, respectively. The wavelengths of maximal absorption (λmax) of the reconstituted L and M opsin photopigments were 564 nm and 532 nm, respectively, in both species. We found one M–L hybrid sequence with a recombinant 277/285 haplotype in Alouatta palliata and two L–M hybrid sequences in A. pigra. The λmax values of the reconstituted hybrid photopigments were in the range of 546~554 nm, which should result in trichromat phenotypes comparable to those found in other New World monkey species. Our finding of color vision variation due to high frequencies of L/M hybrid opsin genes in howlers challenges the current view that howlers are routine and uniform trichromats. These results deepen our understanding of the evolutionary significance of color vision polymorphisms and routine trichromacy and emphasize the need for further assessment of opsin gene variation as well as behavioral differences among subtypes of trichromacy.Electronic supplementary materialThe online version of this article (doi:10.1007/s10764-013-9705-9) contains supplementary material, which is available to authorized users.

Howler monkey foraging ecology suggests convergent evolution of routine trichromacy as an adaptation for folivory

“…Group size ranged from 7 (SE) to 13 (CG). Two females from CG group have previously been analyzed (Matsushita et al., ). It was not possible to match fecal samples to individual monkeys, as our sample collection did not coincide with behavioral observations.…”

“…We targeted exon 3 and exon 5 for PCR and sequencing analyses. The PCR primers were set in the conserved region of the exons between the MWS and the LWS opsin genes of howler monkeys (GenBank accession numbers and : Matsushita et al., ): exon 3, GGGATCACAGGTCTCTGGTC and CCTGCTCCAACCAAAGATGGG, exon 5, GCAAAGCAGCAGAAAGAGTC and CTGCCGGTTCATAAAGACATAGAT. PCR was carried out at 94°C for 5 min followed by 40 cycles at 94°C 30 s, 62°C 30 s, and at 72°C for 1 min.…”

“…Furthermore, these studies predated the verification and discovery of anomalous trichromatic vision in Alouatta . Recently, a recombinant gene, intermediate to MWS and LWS opsins, was found in Costa Rican mantled howlers ( Alouatta palliata; Gray, 1849), and a distinct recombinant M/LWS opsin gene was found in Yucatan black howlers ( A. pigra , Gray, 1849) in Belize (Matsushita, Oota, Welker, Pavelka, & Kawamura, ). However, the consequences of this opsin variation in the context of foraging have yet to be examined.…”

Howler Monkeys

“…And recently, Matsushita et al ( 2013 ) reported that some individuals of A. palliata and A. pigra possess hybrid M-and L-opsin genes, resulting in anomalous trichromatic vision. Importantly, Alouatta also differs from other platyrrhine monkeys in having an unusually high density of cone photoreceptors in the fovea of the central retina (Franco et al 2000 ;Finlay et al 2008 ).…”

“…The goals of these two volumes are to bring together expert scholars, many from habitat countries, to contribute to a comprehensive corpus that reviews, integrates, and evaluates current information on howler behavior, ecology, nutrition, morphology, physiology, reproduction, evolution, and conservation. Moreover, recently published studies on howler systematics, functional morphology, physiology, and nutritional ecology highlight the growing importance of the genus Alouatta as a comparative model for examining platyrrhine evolution and the parallel social and ecological problems faced by species of prosimians, New World monkeys, Old World monkeys, and apes (Rosenberger et al 2009 ;Garber and Kowalewski 2011 ;Benchimol and Peres 2014 ;Halenar and Rosenberger 2013 ;Matsushita et al 2014 ).…”