Comparison of 16S rRNA sequencing with biochemical testing for species-level identification of clinical isolates of Neisseria spp.

Abstract

We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.

Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria

“…Moraxella and Neisseria, for example, once belonged to the same family, Neisseriaceae before a new family, and Moraxellaceae was proposed in 1991 , suggesting insufficient sequence variations for characterization to the species level. It was also reported that the presence of multiple copies of the 16S rDNA gene restricted Neisseria and Paenibacillus species identification. Another limitation of the 16S rDNA sequencing method is that it depends on the quality of the public databases, as sequences are deposited regardless of the correct assignment, length, and the number of ambiguous nucleotides .…”

“…The API phenotypic identification system, which identifies bacteria based on the fermentation of sugars, assimilation of certain carbon sources, and production of unique metabolites and enzymes , had difficulties identifying bacteria with similar biochemical profiles . It is worth noting that ~15% of the clinical bacteria isolates could not be identified using the API kits, emphasizing the limitation of using the API kits.…”

“…16S rDNA sequencing, on the other hand, has emerged as a widely accepted method of choice for the accurate identification of bacteria , and it is also the most well‐represented gene in the public databases (GenBank, European Nucleotide Archive, DNA Data Bank of Japan and The Ribosomal Database Project) . This method capitalizes on the presence of unique variable regions in the gene that are genus or species specific to all bacteria , and comparing the sequences with those available in the public databases . This method is especially useful and practical in healthcare facility settings where a variety of pathogenic bacteria are encountered from patients.…”

Genotyping of commensal Neisseria spp strains by pulsed‐field gel electrophoresis and 16S rRNA gene sequencing

“…For all strains, the 16S rRNA gene was amplified by PCR and sequenced using the primers up1‐F: AGAGTTTGATCCTGGCTCAG and up1‐R: GTTACCTTGTTACGACTT . The PCR thermal program consisted of initial denaturation at 95°C for 5 minutes, 30 cycles of amplification (denaturation at 95°C for 60 seconds, annealing at 54°C for 60 seconds and elongation at 72°C for 90 seconds) and final elongation at 72°C for 10 minutes . The products (1406 bp) were separated with an Applied Biosystems 3730xl DNA analyzer (96 capillary type).…”