Comparison of two different PCR detection methods. Application to the diagnosis of pulmonary tuberculosis

Rodrı́guez, Juan Carlos; Fuentes, Elizabeth; Royo, Gloria

doi:10.1111/j.1699-0463.1997.tb05061.x

Cited by 15 publications

(12 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…There was no significant differcycler (model 4800; Perkin Elmer, Foster City, CA, USA). The mixture of the first amplification reaction consisted of 50 mM of KCl, 10 mM of Tris-HCl, pH 8.3, 2.5 mM of MgCl 2 , 200 µM of each dNTP, 25 pmol of each oligonucleotide (IS1-5'CCTGCGAGCGTAGGCGTCGG3' and IS2-5'CTCGTCCAGCGCCGCTTCGG3') (16) and 2.5 U of Taq DNA polymerase, in a final volume of 50 µL. The denaturing step was carried out at 94°C for 30 s, the annealing step was carried out at 68°C for 1 min, and the extension step was carried out at 72°C for 1 min, totaling 30 cycles.…”

Section: Resultsmentioning

confidence: 99%

“…In order to determine the detection threshold through nPCR, we used a serial dilution curve factor 10, ranging from 10 ng to 0.01 fg. Subsequently, purified DNA 72°C for 30 s, using the oligonucleotides IS3 and IS4 (5'GGTGACAAAGGCCACGTAGG3' and 5'CCAGCACCTAACCGGCTGT3', respectively) (16) for 30 cycles. Of the amplified products, 10 µL were analyzed on a 2.0% agarose gel and stained with ethidium bromide.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Desempenho da técnica nested PCR na detecção específica do complexo Mycobacterium tuberculosis em amostras sanguíneas de pacientes pediátricos

Lima

Montenegro

et al. 2009

J. bras. pneumol.

View full text Add to dashboard Cite

Objective: To evaluate the performance of nested PCR (nPCR) in detecting the Mycobacterium tuberculosis complex in blood samples of patients suspected of having TB, in order to determine its potential for use as an auxiliary tool in the laboratory diagnosis of TB in children. Methods: Detection of the M. tuberculosis complex in blood samples using as a target the insertion sequence IS6110 of the genomic DNA of the bacillus. Blood samples of 120 patients were evaluated. All of the patients were under 15 years of age at the time of their treatment at public hospitals in the city of Recife, Brazil (between January of 2003 and August of 2005). Attending physicians at the hospitals diagnosed TB based on the criteria recommended by the American Thoracic Society. The nPCR amplified a 123-bp fragment with outer oligonucleotides (IS1/IS2) and, in the subsequent reaction, using inner oligonucleotides (IS3/IS4), generating an 81-bp amplicon. Results: Active or latent TB was found in 65 patients, TB was ruled out in 28 suspected cases, and 27 patients were TB-free (controls). The sensitivity of nPCR was 26.15% and was significantly higher for the extrapulmonary form of the disease (55.56%) than for the pulmonary form (18.18%). The specificity was 92.73%. Conclusions: Despite the difficulties in diagnosing TB in children and the low number of cases evaluated in the present study, nPCR in blood samples proved to be a rapid and specific technique, albeit one with low sensitivity. In order to establish its true usefulness in the diagnosis of paucibacillary forms, especially extrapulmonary TB, further studies need to be carried out with a larger sample of children and analyzing biological specimens other than blood.Keywords: Tuberculosis; Diagnosis; Blood; Polymerase chain reaction. ResumoObjetivo: Avaliar o desempenho da técnica nested PCR (nPCR) para detectar o complexo Mycobacterium tuberculosis em amostras de sangue de pacientes com suspeita de TB para sua possível utilização como uma ferramenta auxiliar no diagnóstico laboratorial da doença em crianças. Métodos: Detecção do complexo M. tuberculosis em amostras de sangue usando como alvo a sequência de inserção IS6110 do DNA genômico do bacilo. Foram avaliados 120 pacientes, menores de 15 anos de idade, de ambos os sexos, provenientes de hospitais públicos do Recife (PE), no período entre janeiro de 2003 e agosto de 2005. O diagnóstico de TB foi realizado pelo médico assistente do serviço de saúde de acordo com os critérios da Sociedade Torácica Americana. A nPCR amplificou um fragmento de 123 pb com oligonucleotídeos externos (IS1/IS2) e, na reação subsequente, com oligonucleotídeos internos (IS3/IS4), gerando um amplicon de 81 pb. Resultados: A TB ativa ou latente esteve presente em 65 pacientes, foi descartada em 28 suspeitos e 27 não tinham a doença (controles). A sensibilidade da nPCR foi de 26,15%, sendo significativamente maior na forma extrapulmonar (55,56%) em relação à pulmonar (18,18%), e a especificidade foi de 92,73%. Conclusões: Diante das dificuldades ...

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Desempenho da técnica nested PCR na detecção específica do complexo Mycobacterium tuberculosis em amostras sanguíneas de pacientes pediátricos

Lima

Montenegro

et al. 2009

J. bras. pneumol.

View full text Add to dashboard Cite

show abstract

“…Two amplification processes were performed, one with 10 cycles in the first amplification and 40 cycles in the second (low-sensitivity process), and the other, a high-sensitivity process, with 40 cycles in each amplification (with this methodology it is possible to detect the presence of fewer than 10 copies of bacterial DNA in the sample) [17]. The level of sensitivity of this method was established accordingly with previous studies on Mycobacterium tuberculosis [17], with the extraction of DNA from dilution series of Streptococcus pneumoniae, Escherichia coli and Staphylococcus aureus previously quantified by culture (Nanodrop, Wilmington, Del., USA).…”

Section: Methodsmentioning

confidence: 99%

“…The level of sensitivity of this method was established accordingly with previous studies on Mycobacterium tuberculosis [17], with the extraction of DNA from dilution series of Streptococcus pneumoniae, Escherichia coli and Staphylococcus aureus previously quantified by culture (Nanodrop, Wilmington, Del., USA). In all the reactions, positive and negative controls were included and the positive samples were studied again with different reactants so as to rule out the possibility of cross-contamination of the amplificants.…”

Section: Methodsmentioning

confidence: 99%

Identification of Bacterial DNA in Noninfectious Pleural Fluid with a Highly Sensitive PCR Method

Cremades

Galiana²,

Rodrı́guez³

et al. 2010

Respiration

View full text Add to dashboard Cite

Background: Bacterial DNA due to bacterial translocation has been identified in noninfectious ascitic fluid samples. Objective: This study investigated the possible presence of bacterial DNA in the pleural fluid of patients with pleural effusions of noninfectious origin, using a highly sensitive PCR-based method. Methods: Pleural fluid samples from 175 patients (average age ± SD: 69 ± 14 years) with noninfectious pleural effusion (62 transudates, 113 exudates) were analyzed. Bacterial DNA was detected using nested PCR with amplification of a fragment of the gene r16S, with 2 amplification protocols, i.e. low sensitivity (10 and 40 cycles) and high sensitivity (40 and 40 cycles). Results: With the less sensitive amplification process, only 1 sample was positive (Haemophilus parainfluenzae in a patient with hepatic hydrothorax). With the highly sensitive nested PCR method, bacterial DNA was identified in the pleural fluid, of both transudative and exudative origin, of 75 of the 175 patients (43%). In cases of isolation of a single bacterium, the more frequent were Escherichia coli, Salmonella enterica and Streptococcus pneumoniae.Conclusions: Regardless of its origin, bacterial DNA can be identified in almost half of noninfectious pleural effusions by using a highly sensitive PCR-based method. The possible clinical significance or prognostic value of these findings deserves to be evaluated.

show abstract

“…by Rodriguez et al, 1997) for DNA extraction from MTC obtained by culture of the sputum. Subsequently, the sensitivities of PCR (amplicon was detected by dotblot with a specific probe) and nested PCR were compared.…”

Section: Chemical Methodsmentioning

confidence: 99%

Methods of mycobacterial DNA isolation from different biological material: a review

Hosek¹,

Svastova²,

Morávková³

et al. 2006

Vet. Med.

View full text Add to dashboard Cite

Mycobacteria cause serious infections in animals and human beings. Huge economic losses on farms are caused by selected species of this wide family. A high risk of transmission of infection from animal to human exists. The knowledge of exact pathogen characteristics is an important factor which can improve quick and adequate healing. Cultivation and determination of phenotype is still the "gold standard", but has the disadvantage of taking a long time and also low detection limit. Biochemical characterisation of isolates is not exact, and it is expensive. A more popular method used is the amplification of specific loci by polymerase chain reaction (PCR). For this method, the isolation of sufficient amounts of purified DNA is necessary. In this paper the most frequently used method for DNA isolation from live mycobacterial cells, body fluids, tissues, histological samples and forensic materials are outlined. This paper assists only as guide for these methods, so we describe them briefly.Keywords: Johne's disease; Crohn's disease; zoonoses List of abbreviations: BCG = Bacille Calmette-Guérin; CB18 = C18-carboxypropylbetain; CFU = colony forming units; CPH = N-cetylpyridinium chloride, cerebrospinal fluid; CTAB = cetyltrimethyl ammonium bromide; DNA = deoxyribonucleic acid; DR = direct repeat domain; DTT = dithiotreitol; EDTA = disodium ethylene diamine tetraacetate 2 H 2 O; FB = freezing and boiling; HIV/AIDS = Human Immune-Deficiency Virus/Acquired Immune Deficiency Syndrome; IgG = class G immunoglobulin; IMS = immunomagnetic separation; IS = insertion sequence; LCM = laser capture micro-dissection; MAC = Mycobacterium avium complex; MOTT = mycobacteria other than tuberculosis; MTC = Mycobacterium tuberculosis complex; NALC = N-acetyl-L-cystein; OTN-PCR = one-tube nested polymerase chain reaction; PBS = phosphate-buffered saline; PCI = phenol-chloroform-isoamylalcohol; PCR = polymerase chain reaction; PRA-PCR = polymerase restriction analysis-polymerase chain reaction; RFLP = restriction fragment length polymorphism; rRNA = ribosomal ribonucleic acid; SDS = sodium dodecyl sulphate; TE = Tris-HCl + EDTA buffer; TLC = thin-layer chromatography; TSA = tuberculostearic acid: 10-methyloktadekan acid

show abstract

Comparison of two different PCR detection methods. Application to the diagnosis of pulmonary tuberculosis

Cited by 15 publications

References 30 publications

Desempenho da técnica nested PCR na detecção específica do complexo Mycobacterium tuberculosis em amostras sanguíneas de pacientes pediátricos

Desempenho da técnica nested PCR na detecção específica do complexo Mycobacterium tuberculosis em amostras sanguíneas de pacientes pediátricos

Identification of Bacterial DNA in Noninfectious Pleural Fluid with a Highly Sensitive PCR Method

Methods of mycobacterial DNA isolation from different biological material: a review

Contact Info

Product

Resources

About