Complete nucleotide sequences of the RNAS 2 of German isolates of Grapevine fanleaf and Arabis mosaic nepoviruses

Wetzel, Thierry; Meunier, Liliane; Jaeger, U; Reustle, Götz M.; Krczal, Gabi

doi:10.1016/s0168-1702(01)00235-0

Cited by 54 publications

(39 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…On the other hand, the X1 and VPg of the RNA1, and the 2A of the RNA 2 were the most variable genes on the ArMV genome, confirming previous reports (Wetzel et al, 2001;Ghanem-Sabanadzovic et al, 2005). Interestingly, while only 78% of identity was found between the VPg of ArMV-DU13 and -Lv, 100% identity was found between the VPg of the two ArMV isolates from grapevine (NW and DU13).…”

supporting

confidence: 87%

“…In addition, in the 5' non-coding region, two nucleotide motifs (5'-GAGUUUAAGAAACUC-3') and (5'-TCCGTTAAGAGCGGA-3'), able to form stemloops structures, were found repeated twice before the insertion. This differed from that observed for the nepoviruses Grapevine deformation virus and Grapevine fanleaf virus (GFLV) (Wetzel et al, 2001;Ghanem-Sabanadzovic et al, 2005), in which only the f irst motif was found repeated three times. The signif icance of these insertions and/or deletions is however unknown.…”

contrasting

confidence: 84%

“…The nucleotide sequencing of RNA1 and RNA2 was carried out by an overlapping PCR fragments strategy, using in the initial steps primers described by Wetzel et al (2001). Remaining gaps were amplif ied using sequencespecific primers, which were designed from subsequently obtained sequences.…”

mentioning

confidence: 99%

See 2 more Smart Citations

Short communication. Molecular analysis of the genomic RNAs 1 and 2 of the first Arabis mosaic virus isolate detected in Spanish grapevines

López-Fabuel

Olmos

Baßler

et al. 2013

Span. j. agric. res.

Self Cite

View full text Add to dashboard Cite

The Arabis mosaic virus (ArMV) is one of the causative agent of the grapevine fanleaf disease, one of the most widespread and damaging viral diseases of grapevine. Recently, the ArMV has been detected in Spanish vineyards, and its determination and molecular characterization was undertaken. To this aim, the nucleotide sequence of the genomic RNAs 1 and 2 of the first isolate of ArMV infecting grapevine detected in Spain (ArMV-DU13) has been determined. The ArMV-DU13 genomic sequences were compared to the corresponding sequences of other isolates of ArMV, or nepoviruses. The most divergent genes among ArMV isolates were the X1 and VPg genes on the RNA 1, and the 2A gene on the RNA 2, with identity levels at the amino acid level of 78% (X1 and VPg) or 69% (2A) between the most distant isolates. Interestingly, the VPg genes were identical between the two grapevine isolates ArMV-Du13 and –NW, suggesting a possible implication of the host. The phylogenetic analysis of the RNA 2 showed that the Spanish isolate was close to Grapevine fanleaf virus isolates. The analysis of the full length RNA 2 suggests a recombination event between ArMV-DU13 and GFLV-GHu isolates between nucleotides 54 and 586 in the ArMV-DU13 isolate. Altogether, these results confirm the high variability between isolates of ArMV, and will be helpful to design more appropriate and reliable molecular diagnostic techniques for the control of this emerging virus in Spain.

show abstract

supporting

confidence: 87%

contrasting

confidence: 84%

See 1 more Smart Citation

Short communication. Molecular analysis of the genomic RNAs 1 and 2 of the first Arabis mosaic virus isolate detected in Spanish grapevines

López-Fabuel

Olmos

Baßler

et al. 2013

Span. j. agric. res.

Self Cite

View full text Add to dashboard Cite

show abstract

“…RNA2 codes for a protein (2A HP ) which is required for RNA2 replication and could act as homing protein [10], the movement protein (2B MP ) which is the constituent protein of tubules observed in plasmodesmata [27], and the coat protein (2C CP ) [32]. The complete RNA 1 (7,342 nt) for strain F13 [27], the RNA2 (3,774 nt) for strain F13 [32] and the German isolates, NW [40] have been sequenced.…”

mentioning

confidence: 99%

“…In PCR reactions, two combinations of primers, 5 0 NC/G0 or 5 0 NC/GMPR1, were used. 5 0 NC (5 0 CCAAGAGTTT(A/G)(A/G)GAAACTCA3 0 ) and G0 (5 0 CAGAATTCCCTTACCCTCTC3 0 ) corresponding to nucleotides (nts) 109-128 and 881-900 of GFLV-F13 [32] were designed by [40] as the forward and reverse primers, respectively. Amplification by these primers was expected to produce a 792 bp fragment encompassing 126 nts of 5 0 UTR and 668 nts of 5 0 proximity of 2A HP gene located on the virus RNA2 segment.…”

mentioning

confidence: 99%

Molecular Characterization of Phylogenetically Distinct Isolates of Grapevine fanleaf virus from Iran Based on 2AHP Gene

2012

View full text Add to dashboard Cite

Movement and coat protein genes from Grapevine fanleaf virus (GFLV) isolates have been characterized previously from Iran. In this study, an optimized reverse transcription polymerase chain reaction protocol was established to amplify RNA2 genomic segment corresponding to the hypothetical protein (2A HP ). The sequence of 2A HP was compared with that of previously reported GFLV strains/isolates from other countries which showed 82-86% sequence identities. The 2A HP gene from Iran appeared to be standing distinct from other isolates of GFLV when genetic distance-or parsimony-based phylogeneitc analyses were carried out. The present study for the first time reports characterization of Iranian isolate of GFLV based on 2A HP gene.

show abstract

Molecular Techniques for Detection of Microbial Pathogens

Narayanasamy

Molecular Biology in Plant Pathogenesis and Disease Management

View full text Add to dashboard Cite

Detection, identification and differentiation of microbial plant pathogens -oomycetes, fungi, bacteria, phytoplasmas, viruses and viroids -infecting various crops constitute the basic step for the development of effective crop disease management systems. The conventional cultural methods involving isolation and studying the morphological characteristics using microscope are labor intensive and cumbersome, yielding sometimes, inconclusive results. The molecular techniques, on the other hand, are able to provide precise, reliable and reproducible results rapidly, facilitating early disease management decisions. Biochemical, immunological and nucleic acid-based assays have been preferred, because of the distinct advantages over the conventional methods. The molecular techniques have been very useful in the identification of obligate pathogens causing diseases such as downy mildews, powdery mildews and rusts and also fungi that grow very slowly in the culture media, taking several weeks to produce spore forms that can be used for identification. The availability of antisera, primers and commercial kits has led to widespread application of the molecular techniques for on-site detection during field surveys for assessing the distribution of existing pathogens, occurrence of new/introduced pathogens or strains and for preventing introduction of new pathogens through seeds or planting materials. Furthermore, molecular techniques have been demonstrated to be useful in breeding programs to identify sources of resistance to disease(s). Several protocols for molecular techniques, useful for researchers and students are presented in the Appendix.

show abstract

Complete nucleotide sequences of the RNAS 2 of German isolates of Grapevine fanleaf and Arabis mosaic nepoviruses

Cited by 54 publications

References 23 publications

Short communication. Molecular analysis of the genomic RNAs 1 and 2 of the first Arabis mosaic virus isolate detected in Spanish grapevines

Short communication. Molecular analysis of the genomic RNAs 1 and 2 of the first Arabis mosaic virus isolate detected in Spanish grapevines

Molecular Characterization of Phylogenetically Distinct Isolates of Grapevine fanleaf virus from Iran Based on 2AHP Gene

Molecular Techniques for Detection of Microbial Pathogens

Contact Info

Product

Resources

About