Comprehensive detection of single base changes in human genomic DNA using denaturing gradient gel electrophoresis and a GC clamp

Abrams, Ezra S.; Murdaugh, Susan E.; Lerman, Leonard S.

doi:10.1016/0888-7543(90)90188-z

Cited by 122 publications

(59 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The latter primers are: exon 1: 5ЈCGCGGCGGCTGCCTGGTCCTC3Ј (forward) and 1: 5ЈGGCCGCAG-CCCC-AGAAAGAACC3Ј (reverse); exon 2: 5ЈTTAAAGTAGAAATCT-GTGTATGTG3Ј (forward); exon 7.1: 5ЈATGCACAGGGATGTCCG-GCTC3Ј (reverse); exon 7.2: 5ЈCAACAGTGATGGGAGT GTGAC3Ј (forward); exon 8: 5ЈTCTCCCTCCATTGTGCCTTGTTGTGAT3Ј (reverse); exon 9.1: 5ЈACTTGCAGTTGGCCATCCTGA3Ј (reverse); exon 9.2: 5ЈAGAAAAGGTGGAATTCAAACA3Ј (forward); exon 11.1: 5ЈTTGCT-AGCATAATTCTCTTTCTCTTG3Ј (forward); exon 11.1: 5ЈTTCCCCT-TAAGAGCAGAGCAT3Ј (reverse); exon 11.2: 5ЈTCCTGCAAGTAT-AAG G T GACTGTCCA3Ј (forward); exon 13: 5ЈGCCTGGAATA-GAATCTAGTAAGTC3Ј (reverse); exon 14: 5ЈAGGGTCTCGTGCTTTT-TCTACAAAT3Ј (forward). A 40-base GC-clamp was incorporated on the 5Ј-end of either the forward or reverse primer to increase the sensitivity of the TGGE technique (13,14).…”

Section: Methodsmentioning

confidence: 99%

The Importance of Autosomal Genes in Kallmann Syndrome: Genotype-Phenotype Correlations and Neuroendocrine Characteristics

Oliveira¹

2001

Journal of Clinical Endocrinology & Metabolism

121

120

View full text Add to dashboard Cite

Kallmann syndrome (KS) consists of congenital, isolated, idiopathic hypogonadotropic hypogonadism (IHH) and anosmia. The gene responsible for the X-linked form of KS, KAL, encodes a protein, anosmin, that plays a key role in the migration of GnRH neurons and olfactory nerves to the hypothalamus. In addition to X-linked pedigrees, autosomal dominant and recessive kindreds with KS have been reported. The relative importance of these autosomal vs. X-linked genes in producing KS, and the frequency of KAL mutations, are currently unknown because these are rare disorders and large series are unusual.We examined 101 individuals with IHH (Ϯ anosmia) and their families to determine their modes of inheritance, incidence of mutations in the coding sequence of KAL, genotype-phenotype correlations, and [in a subset (n ϭ 38)] their neuroendocrine phenotype.Of the 101 patients, 59 had true KS (IHH ϩ anosmia/hyposmia); whereas, in the remaining 42, no anosmia was evident in the patients or their families. Of the 59 KS patients, 21 were familial, whereas 38 were sporadic cases. Mutations in the coding sequence of KAL were identified in only 3 of 21 familial cases (14%) and 4 of 38 (11%) of the sporadic cases. Of the X-linked cases confirmed by mutational analysis, only 1 of 3 pedigrees appeared X-linked by inspection whereas the other 2 contained only affected brothers. Female members of known KAL mutation families (n ϭ 3) exhibited no reproductive phenotype and were not anosmic, whereas families with anosmic women (n ϭ 3) were not found to carry mutations in KAL. Mutations were uniformly absent in nonanosmic IHH probands (n ϭ 42), as well as in families with both anosmic and nonanosmic members (n ϭ 2). Overall, 4 novel mutations were identified (C172R, R191ϫ, R457ϫ, and delC@L600).With respect to neuroendocrine phenotype, KS men with documented KAL mutations (n ϭ 8) had completely apulsatile LH secretion, whereas those with autosomal modes of inheritance demonstrated a more variable spectrum with evidence of enfeebled (but present) GnRH-induced LH pulses.Our conclusions are: 1) Confirmed mutations in the coding sequence of the KAL gene occur in the minority of KS cases, i.e. only 14% of familial and 11% of sporadic cases; 2) The majority of familial (and presumably sporadic) cases of KS are caused by defects in at least two autosomal genes that are currently unknown; 3) Obligate female carriers in families with KAL mutations have no discernible phenotype; 4) KAL mutations are uniformly absent in patients with either normosmic IHH or in families with both anosmic and nonanosmic individuals; and 5) Patients with KAL mutations have apulsatile LH secretion consistent with a complete absence of GnRH migration of GnRH cells into the hypothalamus, whereas evidence of present (but enfeebled) GnRH-induced LH pulses may be present in autosomal KS cases. Taken together, these findings suggest that autosomal genes account for the majority of familial cases of KS, and that unique neuroendocrine phenotypes consistent with some GnRH n...

show abstract

Section: Methodsmentioning

confidence: 99%

The Importance of Autosomal Genes in Kallmann Syndrome: Genotype-Phenotype Correlations and Neuroendocrine Characteristics

Oliveira¹

2001

Journal of Clinical Endocrinology & Metabolism

121

120

View full text Add to dashboard Cite

show abstract

“…MELT 87 and SQHTX computer programs, 8 which allow simulation of the melting behaviour of any DNA sequence, were used to optimise the DGGE conditions. To ensure that the DNA portion of interest was within the lowest melting temperature domain, a GC rich region was added at one end of the fragment to be screened as described.…”

Section: Blood Collectionmentioning

confidence: 99%

Analysis of the genotypes and phenotypes of 37 unrelated patients with inherited factor VII deficiency

et al. 2001

View full text Add to dashboard Cite

Severe inherited factor VII (FVII) deficiency is a rare autosomal recessive disorder with a poor relationship between FVII coagulant activity and bleeding tendency. Both clinical expression and mutational spectrum are highly variable. We have screened for mutations the FVII gene of 37 unrelated patients with a FVII coagulant activity less than 5% of normal pooled plasmas. The nine exons with boundaries and the 5' flanking region of the FVII gene were explored using a combination of denaturing gradient gel electrophoresis and direct DNA sequencing. This strategy allowed us to characterise 68 out of the 74 predicted FVII mutated alleles. They corresponded to a large panel of 40 different mutations. Among these, 18 were not already reported. Genotypes of the severely affected patients comprised, on both alleles, deleterious mutations which appeared to be related to a total absence of activated FVII. We suggest that this absence of functional FVII can explain the severe clinical expression. Whether a small release of FVII is sufficient to initiate the coagulation cascade and to prevent the expression of a severe phenotype, requires further investigations.

show abstract

“…In short, amplified DNA is electrophoresed through an increasing gradient of denaturants, urea, and formamide (UF), at a fixed elevated temperature [Fischer and Lerman, 1983]. To facilitate mutation detection, a GC-rich fragment (GC-clamp) is introduced during amplification [Abrams et al, 1990;Myers et al, 1985;Sheffield et al, 1989]. Heteroduplexing results in the formation of mismatched heteroduplex bands, allowing for easy visualization of heterozygous sequence variation.…”

Section: Introductionmentioning

confidence: 99%

Assessing high-resolution melt curve analysis for accurate detection of gene variants in complex DNA fragments

et al. 2009

View full text Add to dashboard Cite

Mutation detection has, until recently, relied heavily on the use of gel-based methods that can be both time consuming and difficult to design. Nongel-based systems are therefore important to increase simplicity and improve turn around time without compromising assay sensitivity and accuracy, especially in the diagnostic/ clinical setting. In this study, we assessed the latest of the nongel-based methods, namely high-resolution melt (HRM) curve analysis. HRM is a closed-tube method that incorporates a saturating dye during DNA amplification followed by a monitoring of the change in fluorescence as the DNA duplex is denatured by an increasing temperature. We assessed 10 amplicons derived from eight genes, namely SERPINA1, CXCR7, MBL, VDR, NKX3A, NPY, TP53, and HRAS using two platforms, the LightScanner s System using LC Green s PLUS DNA binding dye (Idaho Technology, Salt Lake City, UT, USA) and the LightCycler s 480 using the HRM Master dye (Roche Diagnostics, Indianapolis, IN, USA). DNA variants (mutations or polymorphims) were previously identified using denaturing gradient gel electrophoresis (DGGE) a method, similarly to HRM, based upon the different melting properties of doublestranded DNA. Fragments were selected based on variant and fragment complexity. This included the presence of multiple sequence variants, variants in alternate orientations, and single or multiple variants (constitutional or somatic) in GC-rich fragments. We demonstrate current limitations of the HRM method for the analysis of complex DNA regions and call for caution when using HRM as the sole method to make a clinical diagnosis based on genetic analysis.

show abstract

Comprehensive detection of single base changes in human genomic DNA using denaturing gradient gel electrophoresis and a GC clamp

Cited by 122 publications

References 21 publications

The Importance of Autosomal Genes in Kallmann Syndrome: Genotype-Phenotype Correlations and Neuroendocrine Characteristics

The Importance of Autosomal Genes in Kallmann Syndrome: Genotype-Phenotype Correlations and Neuroendocrine Characteristics

Analysis of the genotypes and phenotypes of 37 unrelated patients with inherited factor VII deficiency

Assessing high-resolution melt curve analysis for accurate detection of gene variants in complex DNA fragments

Contact Info

Product

Resources

About