Construction of shRNA Expression Plasmids for Silkworm Cell Lines Using Single-Stranded DNA and Bst DNA Polymerase

CRISPR/Cas9, a bacterial adaptive immune system derived genome-editing technique, has become to be one of the most compelling topics in biotechnology. Bombyx mori is an economically important insect and a model organism for studying lepidopteran and arthropod biology. Here we reported highly efficient and multiplex genome editing in B. mori cell line and heritable site-directed mutagenesis of Bmku70, which is required for NHEJ pathway and also related to antigen diversity, telomere length maintenance and subtelomeric gene silencing, using CRISPR/Cas9 system. We established a simple and practicable method and obtained several Bmku70 knockout B. mori lines, and showed that the frequency of HR was increased in embryos of the Bmku70 knockout B. mori. The mutant lines obtained in this study could be a candidate genetic resource for efficient knock-in and fundamental research of DNA repair in B. mori. We also provided a strategy and procedure to perform heritable genome editing of target genes with no significant phenotype effect.

show abstract

“…1A and 1B). The high expression level of gRNA was provided by a polymerase III U6-promoter cloned from B. mori 31 (Fig. 1B).…”

Section: Resultsmentioning

confidence: 99%

CRISPR/Cas9 mediated multiplex genome editing and heritable mutagenesis of BmKu70 in Bombyx mori

Chang

Wang

et al. 2014

Sci Rep

131

View full text Add to dashboard Cite

show abstract

“…A transgenic silkworm line that expresses the BmBlos2 shRNA under the control of the U6 promoter ( U6-Blos2 shRNA ) was used to determine the shRNA-mediated silencing efficiency (Fig. 1 F) 47 , 48 . BmBlos2 plays important role in silkworm urate granule synthesis in the silkworm larval epidermis.…”

Section: Resultsmentioning

confidence: 99%

Enhancement of Larval RNAi Efficiency by Over-expressing Argonaute2 in Bombyx mori

Zeng

Lin

et al. 2015

Int. J. Biol. Sci.

View full text Add to dashboard Cite

RNA interference has been described as a powerful genetic tool for gene functional analysis and a promising approach for pest management. However, RNAi efficiency varies significantly among insect species due to distinct RNAi machineries. Lepidopteran insects include a large number of pests as well as model insects, such as the silkworm, Bombyx mori. However, only limited success of in vivo RNAi has been reported in lepidoptera, particularly during the larval stages when the worms feed the most and do the most harm to the host plant. Enhancing the efficiency of larval RNAi in lepidoptera is urgently needed to develop RNAi-based pest management strategies. In the present study, we investigate the function of the conserved RNAi core factor, Argonaute2 (Ago2), in mediating B. mori RNAi efficiency. We demonstrate that introducing BmAgo2 dsRNA inhibits the RNAi response in both BmN cells and embryos. Furthermore, we establish several transgenic silkworm lines to assess the roles of BmAgo2 in larval RNAi. Over-expressing BmAgo2 significantly facilitated both dsRNA-mediated larval RNAi when targeting DsRed using dsRNA injection and shRNA-mediated larval RNAi when targeting BmBlos2 using transgenic shRNA expression. Our results show that BmAgo2 is involved in RNAi in B. mori and provides a promising approach for improving larval RNAi efficiency in B. mori and in lepidopteran insects in general.

show abstract

“…The primers used for cloning were listed in the Table S7 . We constructed a shRNA interference vector containing a specific 21 bp fragment initiated by U6 using the method designed by Tanaka [ 85 ] (GFP: GAAGGTTATGTACAGGAAAGT, Mlx: GGCTGACGGACCAAGACAAAT, Mondo: GGATCGACTAGCACAAGTAGC). The RNAi vector was a 21 bp shRNA fragment that was ligated into the U6-pEYFP vector (Solarbio, Beijing, China).…”

Section: Methodsmentioning

confidence: 99%

Domestication Gene Mlx and Its Partner Mondo Are Involved in Controlling the Larval Body Size and Cocoon Shell Weight of Bombyx mori

Qin,

Jiang,

Zhao

et al. 2024

IJMS

View full text Add to dashboard Cite

Bombyx mori was domesticated from Bombyx mandarina. The long-term domestication of the silkworm has brought about many remarkable changes to its body size and cocoon shell weight. However, the molecular mechanism underlying the improvement in the economic characteristics of this species during domestication remains unclear. In this study, we found that a transposable element (TE)—Bm1—was present in the upstream regulatory region of the Mlx (Max-like protein X) gene in wild silkworms but not in all domesticated silkworms. The absence of Bm1 caused an increase in the promoter activity and mRNA content of Mlx. Mlx and its partner Mondo belong to the bHLHZ transcription factors family and regulate nutrient metabolism. RNAi of Mlx and Mondo decreased the expression and promoter activity of glucose metabolism-related genes (trehalose transport (Tret), phosphofructokinase (PFK), and pyruvate kinase (PK)), lipogenic genes (Acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS)), and glutamine synthesis gene (Glutamine synthase 2, (GS2)). Furthermore, the transgenic overexpression of Mlx and Mondo in the fat body of silkworms increased the larval body size, cocoon shell weight, and egg number, but the silencing of the two genes resulted in the opposite phenotypes. Our results reveal the molecular mechanism of Mlx selection during domestication and its successful use in the molecular breeding of Bombyx mori.

show abstract

Construction of shRNA Expression Plasmids for Silkworm Cell Lines Using Single-Stranded DNA and Bst DNA Polymerase

Cited by 5 publications

References 16 publications

CRISPR/Cas9 mediated multiplex genome editing and heritable mutagenesis of BmKu70 in Bombyx mori

CRISPR/Cas9 mediated multiplex genome editing and heritable mutagenesis of BmKu70 in Bombyx mori

Enhancement of Larval RNAi Efficiency by Over-expressing Argonaute2 in Bombyx mori

Domestication Gene Mlx and Its Partner Mondo Are Involved in Controlling the Larval Body Size and Cocoon Shell Weight of Bombyx mori

Contact Info

Product

Resources

About