Control of Sty1 MAPK activity through stabilisation of the Pyp2 MAPK phosphatase

Abstract

SummaryIn all eukaryotes tight control of mitogen-activated protein kinase (MAPK) activity plays an important role in modulating intracellular signalling in response to changing environments. The fission yeast MAPK Sty1 (also known as Spc1 or Phh1) is highly activated in response to a variety of external stresses. To avoid segregation of damaged organelles or chromosomes, strong Sty1 activation transiently blocks mitosis and cell division until such stresses have been dealt with. MAPK phosphatases dephosphorylate Sty1 to reduce kinase activity. Therefore, tight control of MAPK phosphatases is central for stress adaptation and for cell division to resume. In contrast to Pyp1, the fission yeast Pyp2 MAPK phosphatase is under environmental control. Pyp2 has a unique sequence (the linker region) between the catalytic domain and the N-terminal MAPK-binding site. Here we show that the Pyp2 linker region is a destabilisation domain. Furthermore, the linker region is highly phosphorylated to increase Pyp2 protein stability and this phosphorylation is Sty1 dependent. Our data suggests that Sty1 activation promotes Pyp2 phosphorylation to increase the stability of the phosphatase. This MAPK-dependent Pyp2 stabilisation allows cells to attenuate MAPK signalling and resume cell division, once stresses have been dealt with.

A tel2 Mutation That Destabilizes the Tel2-Tti1-Tti2 Complex Eliminates Rad3ATR Kinase Signaling in the DNA Replication Checkpoint and Leads to Telomere Shortening in Fission Yeast

“…6A). To ensure accurate quantification, three separate samples were analyzed by using Ponceau S staining as the loading controls (41). We found that Rad3 in tel2-C307Y cells was reduced to 60.1% Ϯ 1.3% (n ϭ 3) of the wild-type level (Fig.…”

Fission Yeast SCYL1/2 Homologue Ppk32: A Novel Regulator of TOR Signalling That Governs Survival during Brefeldin A Induced Stress to Protein Trafficking

“…Alkaline phosphatase coupled secondary antibodies were used for all blots, followed by direct detection with NBT/BCIP (VWR International Ltd.) substrates on PVDF membranes (Millipore). Ponceau S staining was used as a loading control [ 63 ]. Relative protein levels were quantified in ImageJ and GraphPad Prism was used to calculated significant differences.…”

The role of Rsv1 in the transcriptional regulation of genes involved in sugar metabolism for long‐term survival

“…TCCACTCTTCAAGCCTCGTA TAGAAGAAAAGGCAGAGGCT rsv1- (5) CTAGCGCTGGTCTCTTCATT TGGAAACAAGTAAACGCCCG rsv1- (6) CTTCCCCCACAATCTTAATTC AGTGGAAAAGGCCGATTCCA rsv1- (7) CTTGCAAGCCCAATCTAAGC CGCCTGCTGATTCTGAAATAG rsv1- (8) TGAGGTAACATTTCCGCAGC GACGAAGAGGGTAAACGAAAC rsv1- (9) ACGTCCTCGGAAATCCAACT CGCCGTTAGTGTGAAATGAAG gcd1…”

“…Similar to the high-osmolarity glycerol pathway in budding yeast, which is activated by several stresses, Abbreviations bZIP, basic leucine zipper; EGFP, enhanced green fluorescent protein; MAPK, mitogen-activated protein kinase; PKA, protein kinase A. the MAPK protein Sty1, a S. pombe homolog of Hog1, responds to many different environmental stresses, such as high osmolarity, oxidation, heat shock, and nutrient depletion, and plays a crucial role in cell survival [4][5][6]. Atf1, the main effector protein of Sty1, is normally localized to the nucleus and is directly phosphorylated by activated Sty1 under stress conditions [7].…”