Corneal Dystrophy-Causing SLC4A11 Mutants: Suitability for Folding-Correction Therapy

Loganathan, Sampath K.; Casey, Joseph R.

doi:10.1002/humu.22601

Cited by 35 publications

(42 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…38 This work estimated that cells of CHED2 carriers, who are unaffected, would have approximately 60% of WT function, FECD heterozygous cells 25% and CHED2 patients 5%. Thus, a therapy restoring the function of a CHED2 patient to 25% of WT levels could potentially delay disease for decades, as is seen in FECD patients.…”

Section: Discussionmentioning

confidence: 99%

Ophthalmic Nonsteroidal Anti-Inflammatory Drugs as a Therapy for Corneal Dystrophies Caused by SLC4A11 Mutation

Kumari

Casey

2018

Invest. Ophthalmol. Vis. Sci.

Self Cite

View full text Add to dashboard Cite

Citation: Alka K, Casey JR. Ophthalmic nonsteroidal anti-inflammatory drugs as a therapy for corneal dystrophies caused by SLC4A11 mutation. Invest Ophthalmol Vis Sci. 2018;59:4258-4267. https://doi.org/ 10.1167/iovs.18-24301 PURPOSE. SLC4A11 is a plasma membrane protein of corneal endothelial cells. Some mutations of the SLC4A11 gene result in SLC4A11 protein misfolding and failure to mature to the plasma membrane. This gives rise to some cases of Fuchs' endothelial corneal dystrophy (FECD) and congenital hereditary endothelial dystrophy (CHED). We screened ophthalmic nonsteroidal anti-inflammatory drugs (NSAIDs) for their ability to correct SLC4A11 folding defects.METHODS. Five ophthalmic NSAIDs were tested for their therapeutic potential in some genetic corneal dystrophy patients. HEK293 cells expressing CHED and FECD-causing SLC4A11 mutants were grown on 96-well dishes in the absence or presence of NSAIDs. Ability of NSAIDs to correct mutant SLC4A11 cell-surface trafficking was assessed with a bioluminescence resonance energy transfer (BRET) assay and by confocal microscopy. The ability of mutant SLC4A11-expressing cells to mediate water flux (SLC4A11 mediates water flux across the corneal endothelial cell basolateral membrane as part of the endothelial water pump) was measured upon treatment with ophthalmic NSAIDs.RESULTS. BRET-assays revealed significant rescue of SLC4A11 mutants to the cell surface by 4 of 5 NSAIDs tested. The NSAIDs, diclofenac and nepafenac, were effective in moving endoplasmic reticulum-retained missense mutant SLC4A11 to the cell surface, as measured by confocal immunofluorescence. Among intracellular-retained SLC4A11 mutants, 20 of 30 had significant restoration of cell surface abundance upon treatment with diclofenac. Diclofenac restored mutant SLC4A11 water flux activity to the level of wild-type SLC4A11 in some cases.CONCLUSIONS. These results encourage testing diclofenac eye drops as a treatment for corneal dystrophy in patients whose disease is caused by some SLC4A11 missense mutations.

show abstract

Section: Discussionmentioning

confidence: 99%

Ophthalmic Nonsteroidal Anti-Inflammatory Drugs as a Therapy for Corneal Dystrophies Caused by SLC4A11 Mutation

Kumari

Casey

2018

Invest. Ophthalmol. Vis. Sci.

Self Cite

View full text Add to dashboard Cite

show abstract

“…54 E143K was chosen because dimerization with monomers that traffic to the plasma membrane resulted in a heterodimer at the plasma membrane. 27 These strategies suggest that these proteins have the potential to be cell-surface rescued by small molecules. G709E was chosen as a representative mutation for FECD.…”

Section: Amplex Red High Throughput Assay Of Cell Surface Slc4a11 Abumentioning

confidence: 99%

“…27 Double HA-epitope tags were inserted at cDNA positions encoding amino acid 530 or 564, using untagged pSKL1 as template. HA530-SLC4A11 was constructed, using the forward primer 5 0 -ggtaaagtccacctgctgtc-3 0 and the reverse primer 5 0 -gctgacaagggatgaagtagcgtaatctggaacatcgtatgggtaccctccgccagcgt aatctggaacatcgtatgggtacctttttgtgtgatagtcgtcc-3 0 , which contains the double HA-epitope tag (underlined).…”

Section: Dna Constructsmentioning

confidence: 99%

“…[8][9][10][11][12][13][14][15][16][17][18][19][20][21][22][23][24][25] Some ER-retained mutants of SLC4A11 could be rescued to the cell surface in cells cultured at 308C, suggesting a temperature-sensitive folding defect. 26 Moreover, the rescued protein displayed functional activity upon rescue, 27 suggesting that rescue from the ER is a promising therapeutic approach. SLC4A11 is an attractive therapeutic target as its mutations cause corneal defects leading to blindness.…”

mentioning

confidence: 99%

“…41 Mutant SLC4A11 does not induce apoptosis in HEK293 cells on its own. 27 One report found that HEK293 cells transfected with mutant SLC4A11 decrease expression of antioxidant proteins, rendering the cells more susceptible to oxidative stress. 45 Finally, three independent slc4a11 À/À mouse lines manifest varying degrees of corneal abnormalities, [46][47][48] indicating that loss of SLC4A11 function causes corneal dysfunction.…”

mentioning

confidence: 99%

See 2 more Smart Citations

High Throughput Assay Identifies Glafenine as a Corrector for the Folding Defect in Corneal Dystrophy–Causing Mutants of SLC4A11

Chiu

Mandziuk

Loganathan

et al. 2015

Invest. Ophthalmol. Vis. Sci.

Self Cite

View full text Add to dashboard Cite

Citation: Chiu AM, Mandziuk JJ, Loganathan SK, Alka K, Casey JR. High throughput assay identifies glafenine as a corrector for the folding defect in corneal dystrophy-causing mutants of SLC4A11. Invest Ophthalmol Vis Sci. 2015;56:7739-7753. DOI:10.1167/ iovs.15-17802 PURPOSE. Protein misfolding, causing retention of nascent protein in the endoplasmic reticulum (ER), is the most common molecular phenotype for disease alleles of membrane proteins. Strategies are needed to identify therapeutics able to correct such folding/trafficking defects. Mutations of SLC4A11, a plasma membrane transport protein of the human corneal endothelial cell layer, cause cases of congenital hereditary endothelial dystrophy, Harboyan syndrome, and Fuchs' endothelial corneal dystrophy. Most SLC4A11 mutations induce SLC4A11 misfolding and retention in the ER.METHODS. An assay amenable to high-throughput screening was developed to quantify SLC4A11 at the plasma membrane, enabling a search for potential traffic-correcting small molecules. The assay was validated by comparing cell surface abundance of SLC4A11 mutants measured in the assay to observations from confocal immunofluorescence and values from cell surface biotinylation. Functionality of mutant proteins was assessed, using a confocal microscopic green fluorescent protein (GFP) water flux assay where relative rates of cell swelling are compared. RESULTS.A small-scale screen revealed that the nonsteroidal anti-inflammatory drugs (NSAIDs), glafenine, ibuprofen, and acetylsalicylic acid dissolved in 0.2% dimethyl sulfoxide (DMSO), partially rescued the trafficking defect in some SLC4A11 mutants, expressed in HEK293 cells. These SLC4A11 mutants retained functional activity when rescued to the plasma membrane by glafenine treatment. Glafenine was effective with an EC 50 of 1.5 6 0.7 lM.CONCLUSIONS. These data suggest that glafenine, and perhaps other NSAIDs, hold potential as therapeutics for misfolded membrane proteins, like SLC4A11. The high throughput approach described here can be modified to identify correctors of other misfolded plasma membrane proteins that cause eye disease.

show abstract

SLC4A11 Three-Dimensional Homology Model Rationalizes Corneal Dystrophy-Causing Mutations

2016

Self Cite

View full text Add to dashboard Cite

We studied the structural effects of point mutations of a membrane protein that cause genetic disease. SLC4A11 is a membrane transport protein (OH /H /NH /H O) of basolateral corneal endothelium, whose mutations cause some cases of congenital hereditary endothelial dystrophy and Fuchs endothelial corneal dystrophy. We created a three-dimensional homology model of SLC4A11 membrane domain, using Band 3 (SLC4A1) crystal structure as template. The homology model was assessed in silico and by analysis of mutants designed on the basis of the model. Catalytic pathway mutants p.Glu675Gln, p.His724Arg, and p.His724Ala impaired SLC4A11 transport. p.Ala720Leu, in a region of extended structure of the proposed translocation pore, failed to mature to the cell surface. p.Gly509Lys, located in an open region at the core domain/gate domain interface, had wild-type level of transport function. The molecular phenotype of 37 corneal dystrophy-causing point mutants was rationalized, based on their location in the homology model. Four map to the substrate translocation pathway, 25 to regions of close transmembrane helix packing, three to the dimeric interface, and five lie in extramembraneous loops. The model provides a view of the spectrum of effects of disease mutations on membrane protein structure and provides a tool to analyze pathogenicity of additional newly discovered SLC4A11 mutants.

show abstract

Corneal Dystrophy-Causing SLC4A11 Mutants: Suitability for Folding-Correction Therapy

Cited by 35 publications

References 39 publications

Ophthalmic Nonsteroidal Anti-Inflammatory Drugs as a Therapy for Corneal Dystrophies Caused by SLC4A11 Mutation

Ophthalmic Nonsteroidal Anti-Inflammatory Drugs as a Therapy for Corneal Dystrophies Caused by SLC4A11 Mutation

High Throughput Assay Identifies Glafenine as a Corrector for the Folding Defect in Corneal Dystrophy–Causing Mutants of SLC4A11

SLC4A11 Three-Dimensional Homology Model Rationalizes Corneal Dystrophy-Causing Mutations

Contact Info

Product

Resources

About