Correlation between Legionella pneumophila serogroups isolated from patients with ventilator-associated pneumonia and water resources: a study of four hospitals in Tehran, Iran

Abstract

Legionella pneumophila (L. pneumophila) is one of the main pathogens, causing pneumonia and respiratory tract infections, especially in patients with ventilator-associated pneumonia (VAP). This study aimed to approve the hypothesis that the serogroup distribution of L. pneumophila isolates from patients is correlated with Legionella strains in the environment. A total of 280 bronchoalveolar lavage (BAL) samples from VAP patients admitted to the intensive care unit (ICU) as well as 116 water samples from different sources in four hospitals in Tehran, Iran, were evaluated for the presence of L. pneumophila infection by culture, nested polymerase chain reaction (PCR), real-time PCR, and sequencing for genetic diversity. The molecular and culture methods found 24 (8.6%) and 5 (1.8%) samples to be positive for L. pneumophila in VAP patients, while they found 23 (19.8%) and 8 (6.9%) positive samples in water resources, respectively. The sequencing results indicated that all positive clinical samples and 14 (60.8%) environmental samples were belonged to L. pneumophila serogroup 1. Smoking, age, length of ICU stay, and duration of ventilator use had strong relationship with L. pneumophila infectivity. In conclusion, this is the first report from Iran to determine minor differences in the serogroup distribution of environmental and clinical strains. However, further studies are needed to confirm this relationship in different regions of Iran.Keywords Legionella pneumophila • Ventilator-associated pneumonia • Serogroup 1 • Water resources Abbreviations L. pneumophila Legionella pneumophila VAP Ventilator-associated pneumonia BAL Bronchoalveolar lavage ICU Intensive care unit PCR Polymerase chain reaction BCYE Buffered charcoal yeast extract DST Drug susceptibility test Mip MAcrophage infectivity potentiator DFA Direct fluorescent antibody

Long‐term monitoring of the microbial quality and Legionnaires' disease risk in tap water from mass catering establishments

“…Yakunin et al (2020) demonstrated that 17% of the samples from the hotels and resorts harboured Legionella spp. In another study conducted in Iran, 23 (19.8%) of 116 water samples taken from different water sources such as water taps, air conditioners and drinking water coolers in intensive care units where VIP patients were hospitalized were found to be positive for L. pneumophila (Sakhaee et al, 2022). Similarly, many studies are reporting the frequency of Legionella spp.…”

“…Legionella spp. were identified by real‐time PCR assays using the macrophage infectivity potentiator (MIP) gene primer (Sakhaee et al, 2022). To characterize the MIP genes of L. pneumophila strains, ‘5‐GCAATGTCAACAGCAATGGC‐3’ as forward primer and ‘5‐CATAGCGTCTTGCATGCCTT‐3’ as reverse primer were synthesized.…”

“…Legionella spp. were identified by real-time PCR assays using the macrophage infectivity potentiator (MIP) gene primer (Sakhaee et al, 2022).…”

“…Various studies conducted in Spain (Sanz et al, 2014), Japan (Kuroki et al, 2017), the United States (Craun et al, 2010) and Turkey (Sepin Özen et al, 2017) show that tap water causes LD cases and death. The studies on L. pneumophila have been conducted at homes (Akkaya & Özbal, 2011), hotel water supply systems (Doménech‐Sánchez et al, 2022; Valciņa et al, 2023), air conditioning systems (Kirecci & Daglı, 2019), storage tanks and cooling towers (Logan‐Jackson & Rose, 2022) and healthcare services (Chaudhry et al, 2017; Sakhaee et al, 2022). The shower‐type heads used in the dishwashing units of the mass catering industry are considered suitable environments for the growth and dissemination of pathogenic bacteria such as L. pneumophila , which cause LD, due to the droplets and aerosols they generate.…”

Environmental Monitoring of Legionella in Hospitals in the Campania Region: A 5-Year Study

“…Serogroups 3 and 6 were found in environmental water samples in several studies [ 54 , 80 , 81 , 82 , 83 ]. Particularly, serogroup 3 was isolated in hospitals in Iran [ 84 ], while Pignato et al revealed the prevalence of this serogroup in Italian hospitals, which was sometimes associated with serogroup 6 [ 85 ]. Isolated serogroup 8 was reported by De Giglio et al [ 54 ], Papadakis et al [ 83 ], and Sakhaee et al [ 84 ].…”