CRISPR/Cas9-mediated efficient and heritable targeted mutagenesis in tomato plants in the first and later generations

Abstract

The CRISPR/Cas9 system has successfully been used in various organisms for precise targeted gene editing. Although it has been demonstrated that CRISPR/Cas9 system can induce mutation in tomato plants, the stability of heredity in later generations and mutant specificity induced by the CRISPR/Cas9 system in tomato plants have not yet been elucidated in detail. In this study, two genes, SlPDS and SlPIF4, were used for testing targeted mutagenesis in tomato plants through an Agrobacterium tumefaciens-mediated transformation method. A high mutation frequency was observed in all tested targets in the T0 transgenic tomato plants, with an average frequency of 83.56%. Clear albino phenotypes were observed for the psd mutants. High frequencies of homozygous and biallelic mutants were detected even in T0 plants. The majority of the detected mutations were 1- to 3-nucleotide deletions, followed by 1-bp insertions. The target mutations in the T0 lines were stably transmitted to the T1 and T2 generations, without new modifications or revision. Off-target activities associated with SlPDS and SlPIF4 were also evaluated by sequencing the putative off-target sites, and no clear off-target events were detected. Our results demonstrate that the CRISPR/Cas9 system is an efficient tool for generating stable and heritable modifications in tomato plants.

Light Signaling-Dependent Regulation of Photoinhibition and Photoprotection in Tomato

“…PGR5 CRISPR/Cas9 vector was constructed as described by Pan et al (2016). The 560 target sequence (TTGGAAAGGCAGTGAGATCA) was designed using a web tool of 561 CRISPR-P (Lei et al, 2014 previously described (Fillatti et al, 1987).…”

Heteroduplex Cleavage Assay for Screening of Probable Zygosities Resulting from CRISPR Mutations in Diploid Single Cell Lines

“…More commonly used, but error-prone, the NHEJ pathway randomly inserts or deletes DNA bases (indels) to repair the double-stranded break (3). The most common indels are 1 or 2 bp, but larger indels can occur (4,5). These modifications can result in a loss of gene function by introducing a frameshift mutation or a premature stop codon (6).…”

Development and Use of Biotechnology Tools for Grape Functional Analysis

“…Rice and wheat protoplasts were also studied exhibiting efficient mutagenesis frequencies [137,138]. Besides of being a very promising tool for generating modifications to the genome, the CRISPR/Cas9 system could generate genome modifications that could be present in the germ line and be segregated normally to the next generation of plants without new mutation or reversion [139,143,147]. This encourage the system to be a very promising tool for generating modifications in the genome that can be present in the germ line and be segregated normally to the next generation of plants without new mutation or reversion [139,143,147].…”