Crown-gall-resistant transgenic apple trees that Silence Agrobacterium tumefaciens oncogenes

Gene silencing: concepts, applications, and perspectives in woody plants

“…(Jouanin et al, 2000;Kumar & Fladung, 2001;Hawkins et al, 2003), Solanum dulcamara L. (Curtis et al, 2000), Malus domestica Borkh. (Ko et al, 1998;Dandekar et al, 2004;Viss et al, 2003;Broothaerts et al, 2004;Gilissen et al, 2005;Teo et al, 2006), Pinus radiata D. Don. (Moller et al, 2005;Tang et al, 2005a;2005b;Wagner et al, 2005;Tang et al, 2006), Juglans regia L. (Escobar et al, 2002), Coffea canephora (Ogita et al, 2003), Eucalyptus sp.…”

“…This disease is economically important in fruit and nut orchards, vineyards, and nurseries (Viss et al, 2003). A protection technique based on the silencing of two conserved Agrobacterium genes -tryptophan monooxygenase (iaaM) and isopentenyl transferase (ipt) -have been developed (Escobar et al, 2001;2002).…”

Silencing Agrobacterium oncogenes in transgenic grapevine results in strain-specific crown gall resistance

“…273 In grapevine, only auxin synthesis, which is mediated by 274 iaaM and iaaH, contributes to tumor formation (Huss et al 275 1990); the cytokinin gene (ipt) is not essential (Bonnard 276 et al 1989). Apple roots showed a similar response to 277 oncogenes (Viss et al 2003). Therefore, silencing only 278 iaaM may be sufficient to generate crown-gall-resistant 279 transgenic grapevines.…”

“…Plasmid pJP17 was designed to 106 express complementary sense and antisense RNAs corre-107 sponding to the first 1,797 base pairs of iaaM and the entire 108 ipt coding sequence. The third codon of each gene was 109 converted to a stop codon, and a frameshift mutation was 110 introduced into each oncogene (Viss et al 2003). The iaaM 111 and ipt sequences were fused and situated between 112 opposing cauliflower mosaic virus 35S (CMV 35S) and 113 figwort mosaic virus (FMV) promoters ( Fig.…”

“…DNA samples 121 were analyzed for the presence of the nptII gene by PCR 122 using primers described by Hoffmann et al (1997). The 123 iaaM gene was detected by PCR with primers GA-124 ACCAAGCGGTTGATAACAGCC and CTGCGACTCAT 125 AGTCCAGGAATAC (Viss et al 2003), which amplify a 126 150 bp fragment of the iaaM gene. PCR with iaaM-specific 127 primers began with an initial denaturation at 94°C for 128 2 min, followed by denaturation at 94°C for 1 min, 129 annealing at 50°C for 30 s, and elongation at 72°C for 130 1 min.…”