Cryotherapy Could Not Eradicate Chrysanthemum Stunt Viroid From Infected Argyranthemum Maderense 'Yellow Empire'

Zhang, Z.B.; Haugslien, Sissel; Clark, Jonathan; Spetz, Carl; Blystad, Dag‐Ragnar; Wang, Q.C.; Lee, Y.; Sivertsen, Astrid; Skjeseth, Gry

doi:10.17660/actahortic.2014.1039.26

Cited by 13 publications

(9 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Total RNA was isolated from 100 mg of leaf tissue using the Plant RNA Mini Kit (Omega Bio-Tek, USA) following the manufacturer’s instruction. RT was performed with Superscript II Enzyme (Invitrogen, USA) using 1 μg of total RNA, according to Zhang et al (2014) . After RT reaction, PCR amplification was performed in a C1000TM thermal cycler (BIO-RAD, Singapore), using Tfi polymerase (Invitrogen, USA) and CSVd specific primers (forward primer 5 ′ –3 ′ CGGGACTTACTGTGGTTCC and reverse primer 5 ′ –3 ′ GGAAGGGTGAAAACCCTGTT; Zhang et al, 2014 ).…”

Section: Methodsmentioning

confidence: 99%

“…RT was performed with Superscript II Enzyme (Invitrogen, USA) using 1 μg of total RNA, according to Zhang et al (2014) . After RT reaction, PCR amplification was performed in a C1000TM thermal cycler (BIO-RAD, Singapore), using Tfi polymerase (Invitrogen, USA) and CSVd specific primers (forward primer 5 ′ –3 ′ CGGGACTTACTGTGGTTCC and reverse primer 5 ′ –3 ′ GGAAGGGTGAAAACCCTGTT; Zhang et al, 2014 ). PCR was conducted by subjecting the samples to the following conditions: initial denaturation for 2 min at 95°C, followed by 35 cycles of 95°C for 20 s, 58°C for 30 s and 70°C for 30 s, and a final extension for 7 min at 70°C.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Invasion of shoot apical meristems by Chrysanthemum stunt viroid differs among Argyranthemum cultivars

et al. 2014

View full text Add to dashboard Cite

Chrysanthemum stunt viroid (CSVd) is a damaging pathogen attacking Argyranthemum plants. Our study attempted to reveal distribution patterns of CSVd in shoot apical meristems (SAM) and to explore reasons for differential ability of CSVd to invade SAM of selected Argyranthemum cultivars. Symptom development was also observed on greenhouse-grown Argyranthemum plants. Viroid localization using in situ hybridization revealed that the ability of CSVd to invade SAM differed among cultivars. In diseased ‘Yellow Empire’ and ‘Butterfly’, CSVd was found in all tissues including the uppermost cell layers in the apical dome (AD) and the youngest leaf primordia 1 and 2. In diseased ‘Border Dark Red’ and ‘Border Pink’, CSVd was detected in the lower part of the AD and elder leaf primordia, leaving the upper part of the AD, and leaf primordia 1 and 2 free of viroid. Histological observations and transmission electron microscopy showed similar developmental patterns of vascular tissues and plasmodesmata (PD) in the SAM of ‘Yellow Empire’ and ‘Border Dark Red’, while immunolocalization studies revealed a major difference in the number of callose (β-1, 3-glucan) particles deposited at PD in SAM. A lower number of callose particles were found deposited at PD of SAM of ‘Yellow Empire’ than ‘Border Dark Red’. This difference is most likely responsible for the differences in ability of CSVd to invade SAM among Argyranthemum cultivars.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Invasion of shoot apical meristems by Chrysanthemum stunt viroid differs among Argyranthemum cultivars

et al. 2014

View full text Add to dashboard Cite

show abstract

“…Argyranthemum 'Yellow Empire', one of the most popular cultivars, in North European countries including Norway, was used in the present study. In vitro shoot cultures were established, according to Zhang et al (2014), and maintained on a basic medium (BM) at 23°C under 18-h photoperiod with a light intensity of 50 μmol m −2 s −1 provided by cool-white fluorescent tubes (Philips TL-D Super 80, 58 W/ 840). BM was composed of MS (Murashige and Skoog 1962) medium, supplemented with 3% (w/v) sucrose and 0.6% (w/v) agar.…”

Section: Methodsmentioning

confidence: 99%

“…Cryopreservation of shoot tips by droplet vitrification was conducted, as described by Zhang et al (2014). In brief, shoot tips (about 2.5 mm in length) containing five-to six-leaf primordia excised from 5-wk-old in vitro stock shoots were precultured overnight on BM supplemented with 0.5 M sucrose.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Field performance evaluation and genetic integrity assessment in Argyranthemum ‘Yellow Empire’ plants recovered from cryopreserved shoot tips

Zhang

Skjeseth

Elameen

et al. 2015

In Vitro Cell.Dev.Biol.-Plant

View full text Add to dashboard Cite

Field performance evaluation and genetic integrity assessment were conducted in Argyranthemum plants derived from cryopreserved shoot tips. Some variations in root formation and vegetative growth were found in the plants following cryopreservation, but morphologies of the leaves and flowers, and color, number and size of the flowers remained unchanged in the plants recovered from cryopreservation, compared with the control. Assessments of genetic integrity by the two molecular markers: inter simple sequence repeat (ISSR) and amplified fragment length polymorphism (AFLP) did not detect any polymorphic bands across the plants tested following cryopreservation. These data indicate that cryopreservation reduces, to a certain degree, root formation and vegetative growth, but it does not alter morphologies of leaves and flowers, may not cause any genetic alternations, and has no adverse effects on quantity and quality of the flowers. Therefore, the droplet vitrification cryopreservation can be considered promising for long-term preservation of Argyranthemum germplasm.

show abstract

Long-term preservation of potato leafroll virus, potato virus S, and potato spindle tuber viroid in cryopreserved shoot tips

Chen

Zhao

et al. 2018

Appl Microbiol Biotechnol

View full text Add to dashboard Cite

Availability of and easy access to diverse viruses and viroids are a prerequisite in applied and basic studies related with virus and viroids. Plant viruses and viroids are obligate intracellular parasites that colonize only inside the living cells of the hosts, and long-term preservation of the virus and viroids is difficult. A protocol was described for long-term preservation of Potato leafroll virus, Potato virus S and Potato spindle tuber viroids in cryopreserved shoot tips of potato. Shoot regrowth levels following cryopreservation were higher (58-60%) in 1.5 mm-shoot tips than those (30-38%) in 0.5 mm-ones. All shoots recovered from 0.5 mm-shoot tips were PVS-and PSTVd-preserved, but none of them were PLRV-preserved. Cryopreservation of 1.5 mm-shoot tips resulted in 35%, and 100% of PLRV-, and PVS-and PSTVdpreserved shoots. Studies on cell survival patters and virus localization provided explanations to the varying PLRV-preservation frequencies produced by cryopreservation of the two sizes of shoot tips. Although micropropagation efficiencies were low during after 4 times (12 weeks) of subculture following cryopreservation, similar efficiencies were obtained after 6 times (16 weeks) of subculture in pathogen-preserved shoots recovered from cryopreservation, compared with the diseased in vitro stock shoots (the control). Similar patterns of the concentrations of the three pathogens-preserved shoots by RT-qPCR were similar to those of shoot micropropagation. The three pathogens cryopreserved in shoot tips were readily transmitted by grafting and mechanical inoculation to the potato hosts.PLRV, PVS and PSTVD represent a diverse range of plant viruses and viroids in terms of taxonomy and infectious ability. Therefore, shoot tip cryopreservation opens a new avenue for long-term preservation of the virus and viroids.

show abstract

Cryotherapy Could Not Eradicate Chrysanthemum Stunt Viroid From Infected Argyranthemum Maderense 'Yellow Empire'

Cited by 13 publications

References 0 publications

Invasion of shoot apical meristems by Chrysanthemum stunt viroid differs among Argyranthemum cultivars

Invasion of shoot apical meristems by Chrysanthemum stunt viroid differs among Argyranthemum cultivars

Field performance evaluation and genetic integrity assessment in Argyranthemum ‘Yellow Empire’ plants recovered from cryopreserved shoot tips

Long-term preservation of potato leafroll virus, potato virus S, and potato spindle tuber viroid in cryopreserved shoot tips

Contact Info

Product

Resources

About