Cyclin-dependent kinase complexes in developing maize endosperm: evidence for differential expression and functional specialization

Abstract

Endosperm development in maize (Zea mays L.) and related cereals comprises a cell proliferation stage followed by a period of rapid growth coupled to endoreduplication. Regulation of the cell cycle in developing endosperm is poorly understood. We have characterized various subunits of cyclin-dependent kinase (CDK) complexes, master cell cycle regulators in all eukaryotes. A-, B-, and D-type cyclins as well as A- and B-type cyclin-dependent kinases were characterized with respect to their RNA and protein expression profiles. Two main patterns were identified: one showing expression throughout endosperm development, and another characterized by a sharp down-regulation with the onset of endoreduplication. Cyclin CYCB1;3 and CYCD2;1 proteins were distributed in the cytoplasm and nucleus of cells throughout the endosperm, while cyclin CYCD5 protein was localized in the cytoplasm of peripheral cells. CDKB1;1 expression was strongly associated with cell proliferation. Expression and cyclin-binding patterns suggested that CDKA;1 and CDKA;3 are at least partially redundant. The kinase activity associated with the cyclin CYCA1 was highest during the mitotic stage of development, while that associated with CYCB1;3, CYCD2;1 and CYCD5 peaked at the mitosis-to-endoreduplication transition. A-, B- and D-type cyclins were more resistant to proteasome-dependent degradation in endoreduplicating than in mitotic endosperm extracts. These results indicated that endosperm development is characterized by differential expression and activity of specific cyclins and CDKs, and suggested that endoreduplication is associated with reduced cyclin proteolysis via the ubiquitin–proteasome pathway.Electronic supplementary materialThe online version of this article (doi:10.1007/s00425-013-1990-1) contains supplementary material, which is available to authorized users.

Cell cycle control and seed development

“…The identification and expression of different CDKs expressed in maize endosperm were reported recently (Dante et al, 2014). Previously uncharacterized CDKs of the A-type and B1-types, termed, respectively, CDKA;3 and CDKB1;1, were found to be expressed in endosperm.…”

Expression, regulation and activity of a B2-type cyclin in mitotic and endoreduplicating maize endosperm

“…Maize ( Zea mays L.) B73 plants were grown in the field or a greenhouse and hand-pollinated. Endosperms were dissected from kernels harvested at different stages of development and processed for molecular and immunohistochemical analyses as described in previous publications ( Leiva-Neto et al, 2004 ; Sabelli et al, 2005 , 2013 ; Dante et al, 2014 ).…”

“…Detailed procedures for purification of endosperm RNA and protein and their analyses by RT-PCR and immunoblotting, respectively, are given in previous publications ( Sabelli et al, 2005 , 2013 ; Dante et al, 2014 ). The following RT-PCR primers were used for CYCB2;2: CYCB2;2F (GAAAATGAGGCTAAGAGTTGTGTAAG) and CYCB2;2R (GAGCTCCAGCATGAAAAATGACGCT) and actin: ACT1-F (ATTCAGGTGATGGTGTGAGCCACAC) and ACT1-R (GCCACCGATCCAGACACTGTACTTCC).…”

“…Immunohistochemical localization assays were carried out essentially as described by Dante et al (2014) , except for a monoclonal anti-tubulin antibody (YOL 1/34, Accurate Chemical and Scientific Corp., Westbury, NY, USA), which was used to stain microtubules. Antibodies were utilized at a concentration of 0.5–1 μg/ml.…”

“…Because the mitotic phase of endosperm development produces virtually all the cells involved in storage compound accumulation and because the endoreduplication phase is associated with rapid cell growth and endosperm expansion and filling, it is important to understand how the cell cycle is regulated during these two phases ( Sabelli and Larkins, 2009b ). In this context, three maize CDKs: CDKA;1, CDKA;3, and CDKB1;1; several cyclins belonging to the A1, B1, D2, and D5 types ( Grafi and Larkins, 1995 ; Sun et al, 1999b ; Leiva-Neto et al, 2004 ; Dante et al, 2014 ); two CDK inhibitors ( Coelho et al, 2005 ); a Wee1 homolog ( Sun et al, 1999a ); and members of the retinoblastoma-related (RBR) protein family ( Grafi et al, 1996 ; Sabelli et al, 2005 , 2013 ) have been studied in some detail.…”