Cyr61 is regulated by cAMP‐dependent protein kinase with serum levels correlating with prostate cancer aggressiveness

Abstract

BACKGROUND Cysteine-rich angiogenic inducer 61 (Cyr61) is an extracellular matrix protein involved in the transduction of growth factor and hormone signaling. Previously, we demonstrated that Cyr61 was highly expressed in prostate cancer (PCa) but that the expression levels were associated with a lower risk of PCa recurrence. In the present study, we demonstrate that serum Cyr61 is a potential biomarker that correlates with PCa aggressiveness. Furthermore, we also explore the potential mechanism underlying the changes in Cyr61 expression during PCa progression. METHODS Cyr61 concentrations in the medium from PCa cell lines and in serum samples obtained from PCa patients were measured by sandwich ELISA. Serum Cyr61 levels were correlated with disease characteristics and the association between Cyr61 expression changes by several types of stimulation or stress and cAMP/cAMP-dependent protein kinase (PKA) pathway were examined. RESULTS There was a positive correlation between Cyr61 levels in cell supernatants and mRNA expression in these cell lines. Serum Cyr61 levels were significantly higher in non-organ-confined PCa patients (116.3 ± 140.2 ng/ml) than in organ-confined PCa patients (79.7 ± 56.1 ng/ml) (P = 0.031). Cyr61 expression was up-regulated in response to both lysophosphatidic acid and androgen treatments which promoted PCa cell invasion. Serum starvation and phosphoinositide-3-kinase inhibition also resulted in Cyr61 up-regulation; however, they suppressed cell proliferation. Cyr61 up-regulation was correlated with an increase in cAMP and suppressed by PKA inhibition. CONCLUSIONS These findings suggest that Cyr61 expression in PCa is regulated by the cAMP/PKA pathway and that circulating Cyr61 levels are a potential serum-based biomarker for characterizing PCa.

Matricellular Protein Cyr61 Bridges Lysophosphatidic Acid and Integrin Pathways Leading to Cell Migration

“…Previously, a study demonstrated that Cyr61 mediates thrombin-induced astrocytoma cell proliferation (40). A recent study described that Cyr61 mediates LPAinduced prostate tumor cell invasion, suggesting that Cyr61 is a potential biomarker correlating with prostate cancer aggressiveness (41). Our results that Cyr61 bridges LPA signaling and integrin signaling, leading to SMC migration, demonstrate that Cyr61 is a potentially important molecule that connects intracellular and extracellular information and thus contributes to atherogenesis.…”

The Stress-response protein prostate-associated gene 4, interacts with c-Jun and potentiates its transactivation

“…PCR reactions were subjected to hot start at 95 °C for 3 min followed by 45 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s using the CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.). PCR primers were 5′- CGTAAAGTAGAAGGTGATTG -3′ (forward) and 5′- ATGCTTAGGATTAGGTGGAG -3′ (reverse) for PAGE4, 5′- TAACAGT GGGTGCCAACTCA -3′ (forward) and 5′- TTTTTCTCTCCGTCGCAACT -3′ (reverse) for c-Jun and 5′- GAATATAATCCCAAGC GGTTTG -3′ (forward) and 5′- ACTTCACATCACAGCTCCCC -3′ (reverse) for TATA binding protein (TBP)[45]. Analysis and fold differences were determined using the comparative threshold cycle method.…”

Cyr61 is a potential prognostic marker for prostate cancer

“…We found that Cyr61 expression in PCa was modulated by oncogenic ‘stimulation’ such as androgens or lysophosphatidic acid, as well as anti-oncogenic ‘stress’ such as serum starvation or phosphoinositide 3-kinase inhibition in the tumor environment. 37 These results suggest that differences in Cyr61 expression may reflect the extracellular environmental status of the cancer, which is distinct between PCa and breast cancer.…”

“…Cyr61 levels were significantly higher in NOC-PCa (116.3±140.2 ng ml −1 ) than in OC-PCa (79.7±56.0 ng ml −1 ), although PSA levels were not significantly different (6.4±3.8 ng ml −1 in OC-PCa and 6.1±4.7 ng ml −1 in NOC-PCa, P =0.376) (Figure 2a). 37 Serum Cyr61 levels are not correlated with serum PSA levels and may increase the accuracy for differentiating NOC-PCa from OC-PCa combined with serum PSA levels and other clinical parameters used in PCa staging nomograms. 39 However, serum Cyr61 levels tended to be higher in control patients compared with OC-PCa patients.…”

“…38 The concentration of Cyr61 in the medium alone was 1.1 ng ml −1 and those in the supernatants containing 80% confluent LNCaP, DU145 and PC3 cells were 4.0, 33.5 and 215.1 ng ml −1 , respectively, indicating that the Cyr61 protein secreted by the PCa cells could be measured by the sandwich ELISA. 37 Cyr61 levels were then measured in serum samples obtained from organ-confined (OC)-PCa ( n =58) and non-organ-confined (NOC)-PCa ( n =57) patients. Cyr61 levels were significantly higher in NOC-PCa (116.3±140.2 ng ml −1 ) than in OC-PCa (79.7±56.0 ng ml −1 ), although PSA levels were not significantly different (6.4±3.8 ng ml −1 in OC-PCa and 6.1±4.7 ng ml −1 in NOC-PCa, P =0.376) (Figure 2a).…”